Unlock instant, AI-driven research and patent intelligence for your innovation.

Probes, kits and methods for the recovery and identification of miRNAs associated with Smad3 target genes

A target gene and kit technology, applied in the fields of biotechnology and medicine, can solve the problems of no target gene search method and little effect.

Active Publication Date: 2015-11-25
SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The whole world invests a lot of research funds and manpower in this field every year, but because there is no effective method for finding target genes, although it consumes a lot of manpower and financial resources every year, it still has little effect

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Probes, kits and methods for the recovery and identification of miRNAs associated with Smad3 target genes
  • Probes, kits and methods for the recovery and identification of miRNAs associated with Smad3 target genes
  • Probes, kits and methods for the recovery and identification of miRNAs associated with Smad3 target genes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0098] Example 1: Specific recovery of complementary gene mRNA with labeled probes

[0099] Liver cancer cell line HepG2 and prostate cancer cell line PC-3 were purchased from China Center for Type Culture Collection (CCTCC).

[0100] Will 1×10 3 -1×10 8 (preferably 5×10 6 , so used in this experiment) HepG2 cells were plated into a 10cm plate containing 20ml of complete medium (RPMI1640 medium+10% fetal calf serum, all purchased from PAA Company) and cultured overnight, and the next day, the transfection reagent INTERFERin ( Polyplus company) were transfected with biotin-labeled p21 probe and control probe respectively, and the probe sequences were as follows: P21 probe:

[0101] Biotin-5'-AGAGAGGAAAAGGAGAACACGGGATGAGGAGGCTTTAAATAGTATTTCAT-3' (SEQ ID NO: 1)

[0102] Control probe:

[0103] Biotin-5'-GCTATGAAGAGATACATTAAGGCTATGAAGAGATACATTAAGGCTATGAA-3' (SEQ ID NO: 2)

[0104] Will 1×10 3 -1×10 8 (preferably 5×10 6 , so used in this test) PC-3 cells were spread into...

Embodiment 2

[0149] Example 2: Using p21 probe to specifically recover miRNA combined with p21 gene mRNA

[0150] The RNA recovered by the probe was detected by miRNA quantitative PCR detection chip (Exiqon company):

[0151] The samples recovered with the P21 probe and the samples recovered with the control probe were sent to Shanghai Kangcheng Bioengineering Co., Ltd. for miRNA quantitative PCR chip detection, and the software attached to the PCR instrument was used for preliminary data analysis to obtain the original Ct value.

[0152] The ΔCt of each pathway-related miRNA gene in each treatment group was calculated using the following formula:

[0153] ΔCt=average Ct-average Ct of exogenous internal reference;

[0154] The formula for calculating the ΔΔCt of each gene in the PCR chips of the two treatment groups:

[0155] ΔΔCt=ΔCt(p21)-ΔCt(control).

[0156] The results showed that compared with the control probe, the p21 probe specifically recovered 20 miRNAs (10 times that of th...

Embodiment 3

[0175] Example 3: Regulate the expression of p21 gene with the miRNA recovered specifically by p21 probe

[0176] The following sequences (synthesized by Shanghai Gemma Company) were used to make the most tightly bound miRNAs (miR-92a, miR-92b, miR-296-5p) obtained in Example 2 highly expressed or inhibited in HepG2 cells:

[0177] miR-92a mimic: UAUUGCACUUGUCCCGGCCUGU (SEQ ID NO: 15);

[0178] miR-92b mimic: UAUUGCACUCGUCCCGGCCUCC (SEQ ID NO: 16);

[0179] miR-296-5p mimic: AGGGCCCCCCCUCAAUCCUGU (SEQ ID NO: 17);

[0180] Small RNA control: UUCUCCGAACGUGUCACGUTT (SEQ ID NO: 18, TT protruding at the 3' end is a commonly used modification method in the synthesis of small RNA sequences, which has no effect on its function, mainly to stabilize nucleotides [Wilda, M. et al., Oncogene.2002;21:5176-5124]);

[0181] miR-92a inhibitor: 2'-O-Me-ACAGGCCGGGACAAGUGCAAUA (SEQ ID NO: 19);

[0182] miR-92b inhibitor: 2'-O-Me-GGAGGCCGGGACGAGUGCAAUA (SEQ ID NO: 20);

[0183] miR-296-5p i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for recovering and identifying target gene-correlative miRNA, a kit and a method, concretely nucleic acid probe for recovering and identifying miRNA of target Smad3 gene mRNA, which has a nucleotide sequence of SEQ ID NO:26. The invention provides an action principle for recovering and indentifying the miRNA. The invention discloses application and an implementation strategy of the novel recovery and identification method, particularly recovery and identification of miRNA of specific gene RNA locus applied in a cell. The invention confirms that the locus recovery technology can specifically recover miRNA combined to mRNA of a Smad3 gene, and conforms that the miRNA can regulate and control Smad3 gene expression, and the method can effectively recovering and indentifying miRNA of the target specific gene mRNA.

Description

technical field [0001] The invention belongs to the fields of biotechnology and medicine. Specifically, the present invention relates to the implementation method and application of target gene-related miRNA recovery and identification technology, especially the application in animal cell lines, such as the implementation method and application in human tumor cell lines. Background technique [0002] MicroRNA (miRNA) is about 20-24nt long, non-coding microRNA, which regulates the target gene at the post-transcriptional level by inhibiting mRNA translation or promoting mRNA degradation (Bartel, D.P., Cell. 2004, 116:281-297) . MiRNA is a kind of non-coding small RNA with a very wide range of regulatory functions in cells, controlling almost every biological process, including cell differentiation, development, proliferation and apoptosis. In addition, studies have now shown that miRNA expression level imbalance is closely related to many diseases including tumors, autoimmun...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/11C12N15/10C12Q1/68
Inventor 苏小平曹雪涛
Owner SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY