Assay primer and assay method of PCR-DHPLC (polymerase chain reaction-denaturing high performance liquid chromatography) of transgenic rice KF8 strain
A technology of PCR-DHPLC and transgenic rice, applied in biochemical equipment and methods, measurement/inspection of microorganisms, recombinant DNA technology, etc., can solve problems such as no detection methods, and achieve reliable detection methods, high resolution, and expansion good performance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1D
[0025] Example 1DNA Extraction
[0026] (1) DNA extraction refers to the method provided by the Plant Genomic DNA Extraction Kit (QIAGEN, Cat. No. 69104) and slightly improves the extraction of DNA. The specific operation steps are as follows:
[0027] ① AP1 solution and Buffer AE preheated at 65°C;
[0028] ② After grinding the sample to powder with liquid nitrogen, take an appropriate amount of sample into a 1.5mL centrifuge tube;
[0029] ③Add 400 μL of preheated AP1 solution and 4 μL of 100 mg / mL RNase to the centrifuge tube, mix thoroughly, and put in a water bath at 65°C for 10 min-15 min, during which time shake and mix 2-3 times;
[0030] ④ After the water bath is completed, add 130 μL AP2 solution directly, shake and mix well, and then ice-bath for 5 minutes. Do not shake in the ice-bath, and then centrifuge at 14000r / min for 5 minutes;
[0031] ⑤Pipe the supernatant into the QIA shredder Mini spin column, that is, the purple column in the kit, centrifuge at 14000rp...
Embodiment 2D
[0044] Example 2 DNA concentration determination
[0045] The concentration and purity of the extracted sample DNA were measured; the absorbance values at 260nm and 280nm were measured by an ultraviolet spectrophotometer, and the purity and concentration of nucleic acid were calculated respectively. The calculation formula is as follows:
[0046] DNA purity = OD260 / OD280
[0047] DNA concentration=50×OD260mg / mL
[0048] The purity ratio of DNA was between 1.7 and 1.9, and the concentration was greater than 10ng / μL.
Embodiment 3
[0049] Embodiment 3PCR amplification
[0050] Primers were designed according to the DNA sequence of the transgenic rice KF8 strain (Table 1), and the DNA of the following samples was extracted for specific detection: transgenic rice KF8 strain, non-transgenic rice, transgenic rice Bt63 strain, Kemo rice 1, transgenic rice Kefeng 6 No., Cry1C strain, MON88017 strain, Bt176 strain, MON863 strain, RRS, soybean A2704-12, non-transgenic rape, non-transgenic cotton, potato EH92-527-1, papaya, etc.
[0051] Table 1 Detection primers of transgenic rice KF8 line
[0052] name
Sequence 5'-3'
Seq ID No.
KF8-F
ATGATGACTCAAGCGATGAACCT
1
KF8-R
GGCGACCATGATGCTGTTCT
2
[0053] The total volume of the PCR reaction system is 50 μL, and the components are: PCR reaction solution 10×Buffer 5 μL, 2.5 mmol / L dNTP 5 μL, 10 μmol / L upstream primer and downstream primer 1 μL, 5U / μL Taqpolymerase 0.3 μL, DNA solution 1 μL, and then Make up to 50 μL...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com