Supercharge Your Innovation With Domain-Expert AI Agents!

Assay primer and assay method of PCR-DHPLC (polymerase chain reaction-denaturing high performance liquid chromatography) of transgenic rice KF8 strain

A technology of PCR-DHPLC and transgenic rice, applied in biochemical equipment and methods, measurement/inspection of microorganisms, recombinant DNA technology, etc., can solve problems such as no detection methods, and achieve reliable detection methods, high resolution, and expansion good performance

Inactive Publication Date: 2013-10-02
SHENZHEN AUDAQUE DATA TECH
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no PCR-DHPLC detection method for transgenic rice KF8 line

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Assay primer and assay method of PCR-DHPLC (polymerase chain reaction-denaturing high performance liquid chromatography) of transgenic rice KF8 strain
  • Assay primer and assay method of PCR-DHPLC (polymerase chain reaction-denaturing high performance liquid chromatography) of transgenic rice KF8 strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1D

[0025] Example 1DNA Extraction

[0026] (1) DNA extraction refers to the method provided by the Plant Genomic DNA Extraction Kit (QIAGEN, Cat. No. 69104) and slightly improves the extraction of DNA. The specific operation steps are as follows:

[0027] ① AP1 solution and Buffer AE preheated at 65°C;

[0028] ② After grinding the sample to powder with liquid nitrogen, take an appropriate amount of sample into a 1.5mL centrifuge tube;

[0029] ③Add 400 μL of preheated AP1 solution and 4 μL of 100 mg / mL RNase to the centrifuge tube, mix thoroughly, and put in a water bath at 65°C for 10 min-15 min, during which time shake and mix 2-3 times;

[0030] ④ After the water bath is completed, add 130 μL AP2 solution directly, shake and mix well, and then ice-bath for 5 minutes. Do not shake in the ice-bath, and then centrifuge at 14000r / min for 5 minutes;

[0031] ⑤Pipe the supernatant into the QIA shredder Mini spin column, that is, the purple column in the kit, centrifuge at 14000rp...

Embodiment 2D

[0044] Example 2 DNA concentration determination

[0045] The concentration and purity of the extracted sample DNA were measured; the absorbance values ​​at 260nm and 280nm were measured by an ultraviolet spectrophotometer, and the purity and concentration of nucleic acid were calculated respectively. The calculation formula is as follows:

[0046] DNA purity = OD260 / OD280

[0047] DNA concentration=50×OD260mg / mL

[0048] The purity ratio of DNA was between 1.7 and 1.9, and the concentration was greater than 10ng / μL.

Embodiment 3

[0049] Embodiment 3PCR amplification

[0050] Primers were designed according to the DNA sequence of the transgenic rice KF8 strain (Table 1), and the DNA of the following samples was extracted for specific detection: transgenic rice KF8 strain, non-transgenic rice, transgenic rice Bt63 strain, Kemo rice 1, transgenic rice Kefeng 6 No., Cry1C strain, MON88017 strain, Bt176 strain, MON863 strain, RRS, soybean A2704-12, non-transgenic rape, non-transgenic cotton, potato EH92-527-1, papaya, etc.

[0051] Table 1 Detection primers of transgenic rice KF8 line

[0052] name

Sequence 5'-3'

Seq ID No.

KF8-F

ATGATGACTCAAGCGATGAACCT

1

KF8-R

GGCGACCATGATGCTGTTCT

2

[0053] The total volume of the PCR reaction system is 50 μL, and the components are: PCR reaction solution 10×Buffer 5 μL, 2.5 mmol / L dNTP 5 μL, 10 μmol / L upstream primer and downstream primer 1 μL, 5U / μL Taqpolymerase 0.3 μL, DNA solution 1 μL, and then Make up to 50 μL...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an assay primer and assay method of PCR-DHPLC (polymerase chain reaction-denaturing high performance liquid chromatography) of transgenic rice KF8 strain. The primer is strong in specificity, and can be used in PCR and used for specifically amplifying a DNA (deoxyribonucleic acid) fragment of the transgenic rice KF8 strain, and the amplified product can be applied to subsequent DHPLC analysis. The assay method for the transgenic rice KF strain is convenient to operate, good in extension performance and strong in specificity. The PCR amplified product is analyzed by utilizing the DHPLC, the resolution of the fragment of the PCR amplified product can reach a plurality of basic groups, and the resolution rate is high. According to the primer and assay method provided by the invention, a simple, convenient, effective and reliable assay method is provided to assay of the transgenic rice KF strain and is particularly applicable to port inspection and quarantine and other departments.

Description

technical field [0001] This application relates to the detection of transgenic products, in particular to a PCR-DHPLC detection primer and detection method of a transgenic rice KF8 strain. Background technique [0002] Since the first batch of genetically modified rice came out in 1988, genetically modified rice has developed rapidly and achieved a series of results; the subsequent detection of genetically modified rice has also become a hot spot in various countries. At present, the detection methods of transgenic rice mainly use conventional PCR, real-time fluorescent PCR, Southern blotting, Northern blotting, and gene chip methods. The traditional conventional PCR detection method has certain limitations in terms of platform expansion. With the increase of targets to be detected, it is necessary to re-optimize the amount and ratio of each set of primers in the system, and take into account factors such as amplification efficiency and workload. On the other hand, the comm...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
Inventor 章桂明向才玉凌杏园潘广程颖慧康林
Owner SHENZHEN AUDAQUE DATA TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More