Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Microalgae chloroplast carrier for efficient cloning and expression and application thereof

A chloroplast vector and microalgae technology, which is applied in the direction of introducing foreign genetic material and recombinant DNA technology using a vector, can solve the problems of high experiment time and cost, many restrictive conditions, complicated operation, etc., achieve quick and easy connection, and improve the expression level. Effect

Inactive Publication Date: 2013-10-16
JINAN UNIVERSITY
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the expression efficiency of the exogenous gene in the expression vector has not been reported, and the expression control elements used are not from microalgae, and because the transformation system uses the enzyme digestion method to introduce the exogenous gene into the vector, the operation is complicated, there are many restrictions, and the experiment time is long. and higher cost

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Microalgae chloroplast carrier for efficient cloning and expression and application thereof
  • Microalgae chloroplast carrier for efficient cloning and expression and application thereof
  • Microalgae chloroplast carrier for efficient cloning and expression and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] 1. Design primers

[0046] The upstream and downstream primers of the promoter PrbcL are Pt358 and Pt347, respectively

[0047] Pt358: 5'-gc TCTAGAGCGGCCGC AAACTTCTAAAACTTTCAATTAAAAA

[0048] GCTATTCT-3' (5' restriction site XbaI-NotI)

[0049] Pt347: 5'-TGATTTCTCCTTGGAATAAAAAGGCAATAT-3'

[0050] The upstream primer of PrbcL-XcmI-XcmI is Pt358, and the downstream primers are Pt360a and Pt360b

[0051] Pt360a: 5'-TCCTGGCCA CCACAGGTGTGG TGATTTCTCTTGGAATA

[0052] AAAAGG-3' (5' restriction site XcmI)

[0053] Pt360b: 5'-GTTTTTTGTTCACCA CCACTTCTCCTGG CCACCACAGGTG-3'

[0054] wxya

[0055] The upstream and downstream primers of the terminator TrbcS are Pt344 and Pt359, respectively

[0056] Pt344: 5'-TTTTTAGTAACAAAATAAAATTAAAAAATGTTAAT-3'

[0057] Pt359: 5'-gc GTC GAC CATTTTTTGTCATTGTGATAAGCTAAAGT-3'

[0058] SalI

[0059] The upstream and downstream primers of Myc-TrbcS are Pt357Myc and Pt359, respectively

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a microalgae chloroplast carrier for efficient cloning and expression and application thereof. The microalgae chloroplast carrier provided by the invention comprises a homologous recombination sequence trnI, a homologous recombination sequence trnA, a promoter PrbcL, a terminator TrbcS, an forward XcmI sequence and a reverse XcmI sequence, wherein the forward XcmI sequence and the reverse XcmI sequence are introduced between the promoter PrbcL and the terminator TrbcS so that target gene cloning sites are formed; the homologous recombination sequence trnI is in upstream of the promoter PrbcL; and the homologous recombination sequence trnA is in downstream of the terminator TrbcS. The microalgae chloroplast carrier is characterized in that the promoter and the terminator from the microalgae are utilized to regulate expression of target genes so that the target genes can be efficiently expressed in microalgae chloroplasts.

Description

Technical field: [0001] The invention relates to the field of microalgae genetic engineering, in particular to a highly efficient cloning and expressing microalgae chloroplast carrier and its application. Background technique: [0002] The nuclear gene genetic transformation of plant cells to express foreign genes is the main direction of plant genetic engineering research. However, studies have shown that nuclear transformation technology has disadvantages that are difficult to overcome, such as large nuclear genome, complex background, difficult to control and low expression of foreign genes introduced, unstable expression in offspring, prone to gene inactivation, position effect, gene Silence and other phenomena (Zhang, et al., 2003; Sun, et al., 2003). In addition, nuclear genes are easy to spread with pollen and threaten ecological security (Losey, et al., 1999). [0003] Compared with traditional nuclear gene transformation, chloroplast gene transformation has many a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/79
Inventor 李宏业谢伟红朱聪聪杨维东刘洁生
Owner JINAN UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com