Site-directed modification method of rice genome

A genetic modification and rice technology, applied in the field of plant genetic engineering, can solve problems such as high cost, difficult technology, complicated operation process, etc.

Active Publication Date: 2013-11-06
SUZHOU QI BIODESIGN BIOTECHNOLOGY CO LTD
View PDF0 Cites 33 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the use of these technologies for rice genetic modification is complex, costly, and technically difficult. Therefore, it is urgent to develop more efficient, cheap and simple new technologies for rice genetic modification

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Site-directed modification method of rice genome
  • Site-directed modification method of rice genome
  • Site-directed modification method of rice genome

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0051] 1. Preparation of Cas9 nuclease recombinant expression vector

[0052] The codon optimization of Streptococcus pyogenes Cas9 (SpCas9, Streptococcus pyogenes Cas9) gene was carried out, and the nuclear localization signal (NLS) and BamHI / MfeI restriction enzyme cutting sites were added at both ends of the gene coding sequence to make the optimized Cas9 Better expression and localization in rice. The nucleotide coding sequence of Cas9 after adding NLS and restriction sites at both ends and codon optimization is shown in SEQ ID No. 1 in the sequence listing. In SEQ ID No.: 1, the 1st-6th position is the BamHI restriction site, the 4213-4218th position is the MfeI restriction site, the 10th-36th position is the N-terminal NLS sequence, and the 4162-4209th position is the C-terminal NLS sequence, the 37th-4161st position is the coding gene of Cas9 protein. The coding frame in SEQ ID No.: 1 is the 7th-4212th nucleotide of SEQ ID No.: 1, which encodes the protein shown in SE...

Embodiment 1

[0058] Example 1. Site-directed mutagenesis of rice endogenous gene OsPDS by gRNA:Cas9 system

[0059] (1) Design of target fragments target-SP1 and target-SP2

[0060] target-SP1: GTTGGTCTTTGCTCCTGCAG AGG ; (Locus No. 1353-1375 nucleotides in the OsPDS gene of LOC_Os03g08570.1.)

[0061] target-SP2:GTCCAACCCATTCCTCTGC AGG (Locus No. is the 1366th-1387th nucleotide of the negative strand in the OsPDS gene of LOC_Os03g08570.1.)

[0062] (2) Preparation of pU3-gRNA plasmids containing SP1 or SP2 nucleotide fragments

[0063] SP1 is the coding DNA of the RNA that can complementarily bind to the target target-SP1, and SP2 is the coding DNA of the RNA that can complementarily bind to the target target-SP2.

[0064] Synthesize the following single-stranded primers with sticky ends (underlined):

[0065] SP1-F: GGCA GTTGGTCTTTTGCTCCTGCAG,

[0066] SP1-R: AAAC CTGCAGGAGCAAAGACCAAC;

[0067] SP2-F: GGCA GTCCAACCCATTCCTCTGC,

[0068] SP2-R: AAAC GCAGAGGAATGGGTTGGAC.

...

Embodiment 2

[0079] Example 2. Site-directed mutagenesis of rice endogenous genes OsBADH2 and OsMPK2 by gRNA: Cas9 system

[0080] (1) Design of target fragments target-SP3 and target-SP4

[0081] target-SP3: GCAGATCTTGCAGAATCCT TGG (Locus No. is 1785-1806 nucleotides in the OsBADH2 gene of LOC_Os08g32870.)

[0082] target-SP4: GCGGCGGCCATGGCCATCA CGG Please add (Locus No is 142-163 nucleotides in the OsMPK2 gene of LOC_Os08g06060.)

[0083] (2) Preparation of pU3-gRNA plasmids containing SP3 or SP4 nucleotide fragments

[0084] SP3 is the coding DNA of RNA that can complementarily bind to the target target-SP3, and SP4 is the coding DNA of RNA that can complementarily bind to the target target-SP4.

[0085] Synthesize the following single-stranded primers with sticky ends (underlined):

[0086] SP3-F: GGCA GCAGATCTTGCAGAATCCT,

[0087] SP3-R: AAAC AGGATTCTGCAAGATCTGC;

[0088] SP4-F: GGCAGCGGCGGCCATGGCCATCA,

[0089] SP4-R: AAAC TGATGGCCATGGCCGCCGC.

[0090] After the pri...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene modification method which is capable of realizing random insertion and / or random deletion on a target segment of a rice target gene. The gene modification method comprises following steps: a guide RNA and Cas9 nuclease are induced in rice tissues; the double-chain target segment of the target gene is sliced because of the combined effect of the guide RNA and Cas9 nuclease; and then the random insertion and / or random deletion on the target segment of the rice target gene are / is realized because of DNA self-repairing function of rice cells. The gene modification method is capable of inducing gene mutation of rice.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering and relates to a rice genetic modification method. Background technique [0002] Rice is one of the most important and widely planted crops in the world. The modification of rice genome is conducive to increasing yield, enhancing its resistance to diseases and insect pests and adversity resistance, which is of great significance to agricultural development. In the current genome engineering (Genome engineering) technology, zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) are mainly used for genetic modification. However, the use of these technologies for rice genetic modification is complex, costly, and technically difficult. Therefore, it is urgent to develop more efficient, cheap and simple new technologies for rice genetic modification. [0003] The recently discovered second type of adaptive immune system CRISPR (clustered regularly interspaced...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/09C12N15/63
Inventor高彩霞单奇伟王延鹏李君陈坤玲
OwnerSUZHOU QI BIODESIGN BIOTECHNOLOGY CO LTD