MicroRNA detection method based on non-enzymatic amplification and electrochemiluminescence principles
A technology of non-enzyme amplification and detection method, which is applied in the field of detection of microRNA based on the principle of non-enzyme amplification combined with electrochemiluminescence, which can solve the problems of cumbersome operation and achieve the effect of simple reaction device, simple operation and low cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] The microRNA-21 closely related to human cancer was selected as the detected microRNA. The sequence of microRNA-21 is: UAGCUUAUCAGACUGAUGUUGA.
[0034] The steps for detecting microRNA-21 using the microRNA detection method based on the principle of non-enzyme amplification and electrochemiluminescence are as follows:
[0035] 1) Design DNA hairpin probes
[0036] According to the principle of non-enzymatic amplification and microRNA-21 sequence, the hairpin H1 and hairpin H2 sequences required by the non-enzymatic amplification system were designed; the microRNA-21 sequence was UAGCUUAUCAGACUGAUGUUGA, and the hairpin H1 and hairpin H2 sequences were shown in Table 1. The 3' segment of hairpin H1 is labeled with 6-carbon amino group, and the 3' end of H2 is labeled with biotin.
[0037] Table 1
[0038] name Sequence (5'-3') H1 TCAACATCAGTCTGATAAGCTACCATGTGTAGATAGCTTTATCAGACT (6-carbon amino group labeled at the 3' end) H2 TAAGCTATCTACACATGGT...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 