Sample nucleic acid for single nucleotide polymorphism detection purposes, pcr primer for preparing sample for single nucleotide polymorphism detection purposes, and method for preparing sample for single nucleotide polymorphism detection purposes wh
A technology of single nucleotide polymorphism and ion exchange chromatography, which is applied in the direction of biochemical equipment and methods, microbial measurement/testing, recombinant DNA technology, etc., and can solve problems such as difficult to fully separate
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0100] In Example 1, the separation and detection of wild-type 76bp and mutant-type 79bp of UGT1A1*6 region were carried out.
[0101] (AS-PCR amplification)
[0102] Amplified products of wild type and mutant type were obtained by the AS-PCR conditions shown below.
[0103] (1) test drug
[0104] AccuPrime Taq DNA Polymerase High Fidelity (manufactured by Invitorgen, Lot. 760816)
[0105] 10×AccuPrime PCR Buffer I
[0106] AccuPrime Taq DNA Polymerase High Fidelity (5U / μL)
[0107] UGT1A1*6 primer (manufactured by Operon Biotechnologies)
[0108] Forward (wild type) (10pmol / μL): 5'-(cgcctcgttgtacatcagagcgg)-3'(SEQ ID NO. 1)
[0109] Forward (mutant type) (10pmol / μL): 5'-(ctgacgcctcgttgtacatcagagcga)-3" (sequence number 2)
[0110] Reverse (10 pmol / μL): 5'-(cacatcc tccc t t tggaatggca)-3" (No. 3) nuclease-free water (not treated with DEPC) (manufactured by Ambion, Lot.0803015)
[0111] The wild-type sequence of UGT1A1 gene was inserted into the plasmid (1×10 6 copy / μL)...
reference example 1
[0138] In Reference Example 1, the wild-type 271bp and mutant-type 274bp of the UGT1A1*6 region were separated and detected.
[0139] (AS-PCR amplification)
[0140] Amplified products of wild type and mutant type were obtained under the AS-PCR conditions shown below.
[0141] (1) test drug
[0142] AccuPrime Taq DNA Polymerase High Fidelity (manufactured by Invitorgen, Lot. 760816) 10×AccuPrime PCR Buffer I
[0143] AccuPrime Taq DNA Polymerase High Fidelity (5U / μL)
[0144] UGT1A1*6 primer (manufactured by Operon Biotechnologies)
[0145] Forward (wild type) (10pmol / μL): 5'-(cgcctcgttgtacatcagagcgg)-3'(SEQ ID NO. 1)
[0146] Forward (mutant type) (10pmol / μL): 5'-(ctgacgcctcgttgtacatcagagcga)-3" (sequence number 2)
[0147] Reverse (10pmol / μL): 5'-(gaaagggtccgtcagcatgac)-3" (serial number 4)
[0148] Nuclease-free water (not treated with DEPC) (manufactured by Ambion, Lot.0803015)
[0149] The wild-type sequence of UGT1A1 gene was inserted into the plasmid (1×10 6 cop...
reference example 2
[0194] In Reference Example 2, the separation and detection of wild-type 76bp and mutant-type 79bp in the UGT1A1*6 region were performed.
[0195] HPLC analysis was performed using the anion-exchange column 2 in the same manner as in Example 1, except that sodium chloride was used as the salt added to the eluent B instead of guanidine hydrochloride.
[0196] In Example 1, the chromatogram obtained by separating and detecting the wild-type 76bp and the mutant 79bp of the UGT1A1*6 region is shown in figure 1 (in case of using anion exchange column 1) and figure 2 (When using anion exchange column 2). Depend on figure 1 , 2 The results show that both chromatographic columns can well separate and detect wild-type 76bp and mutant-type 79bp of UGT1A1*6 region amplified by AS-PCR. Especially when the anion exchange column 1 is used, almost complete separation and detection can be achieved in a short time.
[0197] In Reference Example 1, the chromatogram obtained by separating ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| particle size | aaaaa | aaaaa |
| wavelength | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More