Unlock instant, AI-driven research and patent intelligence for your innovation.

Simplified Sanger gene sequencing method

A technology of gene sequencing and sequencing, which is applied in the direction of biochemical equipment and methods, microbial measurement/inspection, etc., can solve the problems of many operation steps, easy to cause pollution, long processing time, etc., and achieve simple operation, shorten operation time, and prevent pollution effect

Inactive Publication Date: 2014-01-01
WUHAN HEALTHCHART BIOLOGICAL TECH
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the need for pre-treatment of samples before Sanger sequencing, the processing time is long, the operation steps are many, and pollution is likely to be caused during the processing, which limits the clinical application of Sanger sequencing.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Simplified Sanger gene sequencing method
  • Simplified Sanger gene sequencing method
  • Simplified Sanger gene sequencing method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] 1. Synthesis of primer probes

[0028] Primers and probes were designed for exons 18, 19, 20 and 21 of the EGFR gene, and the following primers and probes were synthesized by artificial synthesis:

[0029] EGFR18F:TTGTCTCTGTGTTCTTGTCCC

[0030] EGFR18R:TTCCCAAACACTCAGTGAAAC

[0031] EGFR18P:FAM-CCCAGCTTGTGGAGCCTCTTACACCC-BHQ1

[0032] EGFR19F:ACATTATCAGGCTTAGGTGCG

[0033] EGFR19R:CAGACAGTAGAAAAGGTGGGC

[0034] EGFR19P:FAM-CTCCACAGCCCCAGTGTCCCTCA-BHQ1

[0035] EGFR20F: TCCCTGTGCTAGGTCTTTTG

[0036] EGFR20R:TCCCTTCCCTGATTACCTTT

[0037] EGFR20P:FAM-CGATCTGCACACACCAGTTGAGC-BHQ1

[0038] EGFR21F:CTTTCATGCGCCTTTCCAT

[0039] EGFR21R:GCCACCTCCTTACTTTGCCT

[0040] EGFR21P:FAM-ACGTTCGCCAGCCATAAGTCCTCG-BHQ1

[0041] The sequences of the above primers and probes are from the 5' end to the 3' end, F represents the upstream primer, R represents the downstream primer, P represents the probe, FAM represents the fluorescent group in the probe, and BHQ1 represents the quench...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Belonging to the field of biotechnology, the invention discloses a simplified Sanger gene sequencing method. Based on fluorescent quantitative PCR and nucleic acid purification technology, the invention carries out great improvement on the Sanger gene sequencing method, reduces flows and operation steps in the Sanger gene sequencing method and shortens gene sequencing time. The sequencing method provided by the invention is simple and safe for operation, economical and efficient, and does not require expensive reagent; the method can effectively shorten operation time and complete the sequencing process within 4-6 h; and the gene sequencing process can be completely carried out in a 96 orifice plate or8 connected tubes, and does not require test tube transfer, thereby effective preventing pollution.

Description

technical field [0001] The invention belongs to the field of biotechnology and relates to a simplified Sanger method gene sequencing method. Background technique [0002] In molecular biology research, DNA sequence analysis is the basis for further research and modification of target genes. The current technology used for DNA sequencing mainly includes the Sanger dideoxy chain termination method (Chain Termination Method) invented by Frederick Sanger. The Sanger method is based on the nucleotide starting at a fixed point, randomly ending at a specific base, and fluorescently labeling after each base, resulting in four groups ending with A, T, C, and G A series of nucleotides of different lengths, thus forming a large number of extension products with fluorescently labeled ends and different lengths (different termination sites). Then, high-resolution capillary gel electrophoresis is used to separate these extension products. By distinguishing the four different fluorescent...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6869C12Q2535/101
Inventor 叶伦李雪梅付金玲陈刚
Owner WUHAN HEALTHCHART BIOLOGICAL TECH