Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Glycosylated maltose binding protein, and preparation method and application thereof

A technology for binding proteins and maltose, applied in biochemical equipment and methods, chemical instruments and methods, and botanical equipment and methods, etc., can solve problems such as difficulty in operation, heterogeneity of glycoproteins, complicated steps, etc., and achieve simplified steps. Effect

Inactive Publication Date: 2014-01-15
SHANDONG UNIV
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the randomness of the chemical activation of sugar chains, the glycoproteins produced by cross-linking are highly heterogeneous; at the same time, this method has problems such as complicated steps and difficult operation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Glycosylated maltose binding protein, and preparation method and application thereof
  • Glycosylated maltose binding protein, and preparation method and application thereof
  • Glycosylated maltose binding protein, and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Synthesis of maltose-binding protein containing pentapeptide glycosylation sequence (DQNAT)

[0048]According to the central dogma, DNA is transcribed into RNA and RNA is translated into protein. Therefore, the malE gene is modified at the DNA level, the nucleotide sequence encoding DQNAT is inserted, and then the modified malE gene is expressed to obtain the MBP containing the pentapeptide glycosylation site. Take the malE gene in the plasmid pMAL-p5X as a template, and use the malE-178-1, malE-178-2, malE-341-1, malE-341-2, malE-F, and malE-R listed in Table 1 as The primers were inserted into the pentapeptide glycosylation sequence (DQNAT) at the N178 and N341 positions of MBP respectively twice.

[0049] The steps are as shown in the figure, taking inserting DQNAT at bit N178 of the MBP as an example, the specific instructions are as follows:

[0050] 1) The 5' end of the primer malE-178-1 is complementary to the 5' end of malE-178-2, which is responsible for the ...

Embodiment 2

[0057] Construction of Escherichia coli Glycoprotein Synthesis System Mediated by PglB

[0058] Take the model bacteria Escherichia coli O86:K61:B7 as an example to describe the specific steps in detail, as follows:

[0059] Knockout of the waaL gene in E. coli O86:K61:B7. For the knockout method, refer to the λ-Red recombination system. Knockout primers k-waaL-F, k-waaL-R and detection primers t-waaL-F, t-waaL-R were used; the plasmids used were pKD46, pKD4 and pCP20. Knockout validation results such as Figure 4 shown. Some conditions are briefly described as follows:

[0060] (1) Transformation of pKD46 and induced expression of the Red recombination system: transform the plasmid pKD46 encoding the Red recombination gene into E.coli O86:K61:B7 by chemical method, and inoculate it in LB liquid medium containing 100 μg / mL Amp Incubate overnight at 30°C and 250 rpm. Then transfer 1% inoculum to 50mL fresh LB liquid medium containing 1‰Amp, culture for one hour OD600=0.2~...

Embodiment 3

[0069] The preparation method of maltose binding protein expression gene malE-Mut comprises the following steps:

[0070] (1) Design a pair of chimeric primers whose sequences are:

[0071] malE-178-1: 5'TGTTGCGTTCTGGTC,

[0072] malE-178-2: 5'GACCAGAACGCAACA;

[0073] Design the most distant upstream and downstream primers for a pair of template genes, respectively:

[0074] k-waaL-F: CTCGAGAAAAAAAACTGGATAGCGTACTGGAACAGAGCTGTGTAGGCTGGAGCTGCTTC and

[0075] k-waaL-R:TTACTTGTTTTTCATCGCTAATAATAAGCCGGCGTAAACATGGGAATTAGCCATGGTCC;

[0076] Then use malE-178-1 and k-waaL-F as primers and malE gene as template to synthesize PCR fragment k-waaL-F-malE-178-1; then use malE-178-2 and k-waaL-R As a template, synthesize the fragment malE-178-2-k-waaL-R;

[0077] Use the mixture of PCR fragments k-waaL-F-malE-178-1 and malE-178-2-k-waaL-R as a common template, and use the malE gene as a template to synthesize a PCR product and insert pentapeptide sugar at position N178 The malE mutan...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to glycosylated maltose binding protein, and a preparation method and an application thereof. A maltose binding protein expression gene malE-Mut has a nucleotide sequence represented by SEQ ID NO.1. As a TD antigen, the sugar-protein conjugate vaccine can generate long-lasting immunity in the body of a healthy adult. The vaccine is also effective for the high-risk populations.

Description

Technical field: [0001] The invention relates to a preparation method of a glycosylated maltose-binding protein, a preparation method and application thereof, and belongs to the field of biotechnology. Background technique: [0002] Maltose Binding Protein (abbreviation: MBP) is one of the members of the maltose transport system of Escherichia coli, which is mainly responsible for the capture and transport of maltose. Because MBP fusion expression recombinant protein has the advantages of high expression level and easy purification, MBP is often widely used as a fusion tag. In the past, it was generally believed that the MBP tag had no biological activity or low biological activity, and the protein expressed by its fusion could be directly studied for biological activity. However, recent studies have found that MBP, as a carrier protein, can improve the effect of subunit vaccines against pathogenic bacteria. MBP can promote the secretion of cytokines and the maturation of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/31C07K14/245C12N15/10C12N15/70
Inventor 陈敏杨公进马中瑞
Owner SHANDONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com