Kit for detecting genetically modified soybean
A detection kit and genetically modified technology, which is applied in the determination/testing of microorganisms, chemical libraries, combinatorial chemistry, etc., can solve the problems of time-consuming, laborious and high cost, and achieve the effects of improving sensitivity and accuracy, large detection throughput, and simple operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] The soybean transgenic detection kit in this example consists of a primer set and a membrane chip. The primer set is a 7-fold PCR primer set. The 5'-3' base sequences of each pair of primers are as follows:
[0058] Pat: Forward primer: TGATATGGCCGCGGTTTGTGAT
[0059] Reverse primer: GGCCCAGCGTAAGCAATACC
[0060] Bar: Forward primer: GGGGATCTACCATGAGCCCA
[0061] Reverse primer: GGCTCGGTACGGAAGTTGAC
[0062] Cry1Ab: forward primer: CGACATCTCCTTGTCCTTGAC
[0063] Reverse primer: CTCAATTTGCACCAGGAATGC
[0064] Cry105: forward primer: ACTCGATCAGGTACAATGCCA
[0065] Reverse primer: GCATCTGTTAGGCTCTCCAC
[0066] EPSPS: Forward primer: GCGCGATCATACGGAAAAGAT
[0067] Reverse primer: TCGATGACTTGGCCGGTGAG
[0068] P35S: Forward primer: AAGACGTTCCAACCACGTCTTCAA
[0069] Reverse primer: GAGGAAGGGTCTTGCGAAGG
[0070] Lectin: forward primer: CAGCAATATCCTCTCCGATGTG
[0071] Reverse primer: AGGATCAATGTTACTGCTAGCGTG;
[0072] The membrane chip consists of 7 sets of probe seq...
Embodiment 2
[0111] The soybean transgenic detection kit in this example consists of a primer set and a membrane chip. The primer set includes asymmetric PCR amplification primers, which are Tag primers with a biotin marker (biotin) at the 5’ end. The base sequence is as follows:
[0112] Tag primer: biotin-5'-AGACGCCACCGCCAGCGTATTATCCGAGC C-3'.
[0113] The supporting membrane is a nylon membrane.
[0114] The reaction system of PCR amplification is as follows:
[0115] wxya 2 O: 50ul
[0116] 10×PCR Buffer: 5ul
[0117] dNTP (2.5mM each): 5ul
[0118] PCR primers (20μM): 0.5ul each
[0119] Tag primer (20μM): 3.5ul
[0120] EX-Taq Polymerase (Takara, 5U / ul): 0.5ul
[0121] Extracted soybean genomic DNA (about 50ng / ul): 2ul
[0122] Perform PCR cycle amplification on the above reaction system. The PCR cycle conditions are as follows. The reaction process consists of pre-denaturation, multiple PCR cycle 1 and asymmetric PCR cycle 2. The conditions are as follows:
[0123] Pre-dena...
Embodiment 3
[0136] The soybean genetically modified detection kit in this example consists of a primer set, a membrane chip and auxiliary materials. The auxiliary materials are deoxyribonucleoside triphosphate (dNTP), EX-Taq polymerase (Polymerase) and a positive oligonucleotide labeled with biotin at the 5' end. Nucleic acid single-stranded DNA, positive oligonucleotide with biotin mark at the 5' end The base sequence of the single-stranded DNA is biotin-5'-CTGGTACTTTGGA
[0137] CACTCGTTCTTCTCGCACTGCTCATTATTGCTTCTGATCTGGATGC-3'.
[0138] The extracted soybean genomic DNA is the transgenic soybean line A2704-12, and the test results are as follows: figure 2 Shown in B.
[0139] All the other are with embodiment two.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 