Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Kit for detecting genetically modified soybean

A detection kit and genetically modified technology, which is applied in the determination/testing of microorganisms, chemical libraries, combinatorial chemistry, etc., can solve the problems of time-consuming, laborious and high cost, and achieve the effects of improving sensitivity and accuracy, large detection throughput, and simple operation

Active Publication Date: 2014-02-19
SICHUAN HUAHAN TRIO BIOTECH CO LTD
View PDF3 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The purpose of the present invention is to overcome the time-consuming, labor-intensive and high-cost defects of the prior art, and provide a soybean transgenic detection kit with simple operation, fast sensitivity, large detection throughput, visualized detection results, and low cost

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detecting genetically modified soybean
  • Kit for detecting genetically modified soybean
  • Kit for detecting genetically modified soybean

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] The soybean transgenic detection kit in this example consists of a primer set and a membrane chip. The primer set is a 7-fold PCR primer set. The 5'-3' base sequences of each pair of primers are as follows:

[0058] Pat: Forward primer: TGATATGGCCGCGGTTTGTGAT

[0059] Reverse primer: GGCCCAGCGTAAGCAATACC

[0060] Bar: Forward primer: GGGGATCTACCATGAGCCCA

[0061] Reverse primer: GGCTCGGTACGGAAGTTGAC

[0062] Cry1Ab: forward primer: CGACATCTCCTTGTCCTTGAC

[0063] Reverse primer: CTCAATTTGCACCAGGAATGC

[0064] Cry105: forward primer: ACTCGATCAGGTACAATGCCA

[0065] Reverse primer: GCATCTGTTAGGCTCTCCAC

[0066] EPSPS: Forward primer: GCGCGATCATACGGAAAAGAT

[0067] Reverse primer: TCGATGACTTGGCCGGTGAG

[0068] P35S: Forward primer: AAGACGTTCCAACCACGTCTTCAA

[0069] Reverse primer: GAGGAAGGGTCTTGCGAAGG

[0070] Lectin: forward primer: CAGCAATATCCTCTCCGATGTG

[0071] Reverse primer: AGGATCAATGTTACTGCTAGCGTG;

[0072] The membrane chip consists of 7 sets of probe seq...

Embodiment 2

[0111] The soybean transgenic detection kit in this example consists of a primer set and a membrane chip. The primer set includes asymmetric PCR amplification primers, which are Tag primers with a biotin marker (biotin) at the 5’ end. The base sequence is as follows:

[0112] Tag primer: biotin-5'-AGACGCCACCGCCAGCGTATTATCCGAGC C-3'.

[0113] The supporting membrane is a nylon membrane.

[0114] The reaction system of PCR amplification is as follows:

[0115] wxya 2 O: 50ul

[0116] 10×PCR Buffer: 5ul

[0117] dNTP (2.5mM each): 5ul

[0118] PCR primers (20μM): 0.5ul each

[0119] Tag primer (20μM): 3.5ul

[0120] EX-Taq Polymerase (Takara, 5U / ul): 0.5ul

[0121] Extracted soybean genomic DNA (about 50ng / ul): 2ul

[0122] Perform PCR cycle amplification on the above reaction system. The PCR cycle conditions are as follows. The reaction process consists of pre-denaturation, multiple PCR cycle 1 and asymmetric PCR cycle 2. The conditions are as follows:

[0123] Pre-dena...

Embodiment 3

[0136] The soybean genetically modified detection kit in this example consists of a primer set, a membrane chip and auxiliary materials. The auxiliary materials are deoxyribonucleoside triphosphate (dNTP), EX-Taq polymerase (Polymerase) and a positive oligonucleotide labeled with biotin at the 5' end. Nucleic acid single-stranded DNA, positive oligonucleotide with biotin mark at the 5' end The base sequence of the single-stranded DNA is biotin-5'-CTGGTACTTTGGA

[0137] CACTCGTTCTTCTCGCACTGCTCATTATTGCTTCTGATCTGGATGC-3'.

[0138] The extracted soybean genomic DNA is the transgenic soybean line A2704-12, and the test results are as follows: figure 2 Shown in B.

[0139] All the other are with embodiment two.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a kit for detecting genetically modified soybean in the field of test items. The kit for detecting genetically modified soybean comprises a primer combination and a membrane chip. The kit for detecting genetically modified soybean is characterized in that the primer combination is a seven polymerase chain reaction (PCR) primer combinations; each pair of primers comprise Pat, Bar, Cry1Ab, Cry105, EPSPS, P35S and a soybean endogenous gene sequence Lectin; the membrane chip is seven groups of probe sequences, which are orderly fixed on the surface of a support membrane and a group of positive control probe sequences, the probe sequences are respectively a Pat probe, a Bar probe, a Cry1Ab probe, a Cry105 probe, an EPSPS probe, a P35S probe, a Lectin probe and a Positive probe; an asymmetric PCR amplification primer is formed in the primer combination, and is a Tag primer with a biotin marker (biotin) at the 5' end. By adopting the kit for detecting genetically modified soybean, the defects of time and labor waste, and high cost in the prior art are overcome; the provided kit for detecting genetically modified soybean is simple to operate, quick and sensitive, large in detection throughput, visual in detection result and low in cost.

Description

Technical field [0001] The invention relates to the field of detection supplies, in particular to a soybean transgene detection kit. Background technique [0002] Genetically modified corn and genetically modified soybeans are currently the most important genetically modified food crops in the world. Genetically modified soybeans are the earliest commercially planted and fastest-growing genetically modified food crops. Since it was approved for commercial production in 1996, as of 2008, the planting area has reached 65.8 million hectares, accounting for 69% of the global soybean planting area and 53% of the global genetically modified crops. Due to the massive emergence of genetically modified products in the global market, their environmental and food safety issues have also attracted international attention. Various countries have successively formulated and promulgated corresponding laws and regulations, and adopted strict management measures for the environmental relea...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C40B40/06
CPCC12Q1/6837C12Q1/686C12Q2531/107C12Q2537/143C12Q2565/501C12Q2531/113
Inventor 黄广平王勇强秦子苏
Owner SICHUAN HUAHAN TRIO BIOTECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com