Check patentability & draft patents in minutes with Patsnap Eureka AI!

A pcr-rflp method for distinguishing duck circovirus and goose circovirus

A technology of PCR-RFLP and duck circovirus, applied in the field of molecular biology, can solve the problems of cross-species transmission without corresponding reserve detection methods, achieve high efficiency and accuracy, and simple identification methods

Active Publication Date: 2015-09-23
INST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, it has been reported that the nucleotide homology of the protein (Rep protein) encoded by ORF-V1 of DuCV and GoCV can reach more than 80.0%. A primer can be designed to detect DuCV and GoCV infection, but the possible cross-species transmission There is still no corresponding reserve detection method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A pcr-rflp method for distinguishing duck circovirus and goose circovirus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] 1. Virus strains: duck circovirus (GenBank accession number: GQ423744) and goose circovirus (GenBank accession number: GU320569) were isolated, identified and preserved by the Institute of Animal Husbandry and Veterinary Medicine, Fujian Academy of Agricultural Sciences.

[0026] 2. Primer design and synthesis

[0027] Primers P1 and P2 were designed according to the NS gene characteristics of duck circovirus and goose circovirus, wherein the sequences of primers P1 and P2 are: upstream primer P1: 5'- CATGATGGGCAGTGGCTTCCT -3', downstream primer P2: 5'- ACCTCCGTCTTCCAATCA -3' .

[0028] 3. PCR amplification

[0029] The genomic DNA of duck circovirus and goose circovirus was extracted by conventional method. Using the designed specific primers P1 and P2 for PCR amplification, the size of the amplified fragment is about 623bp. The amplification system was 50 μL, including 25 μL of 2×GoTaq Master Green Mix, 1 μL of upstream and downstream primers (20 μM / mL), 1 μL of...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a PCR-RFLP method for distinguishing duck circovirus and goose circovirus. The method utilizes the difference in the enzyme cutting site of the Rep protein gene sequence to distinguish, including DNA extraction and PCR amplification to obtain Rep The protein gene fragment was digested with XhoI and analyzed by RFLP. The identification method of the invention is simple, and the efficiency and accuracy are high.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and in particular relates to a polymerization method for distinguishing duck circovirus and goose circovirus by utilizing the difference in enzyme cleavage sites of the Rep protein gene sequence of waterfowl circovirus (duck circovirus and goose circovirus) Enzyme-linked reaction (PCR)-restriction fragment length polymorphism (RFLP) method. Background technique [0002] Duck infection with circovirus (duck circovirus, DuCV) was first reported by Hattermann et al. in 2003. Chen et al., a Taiwan scholar in my country, tested samples collected in Taiwan from 2002 to 2003 and showed that the detection rate of circovirus was 38.2%. Fu Guanghua and others first reported duck circovirus infection in mainland China. Jiang et al. reported that duck circovirus was detected from ducks. The positive rate was 33.29%, accompanied by duck type 1 viral hepatitis (DHV- I), duck infectious serositis (R...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/68C12R1/93
CPCC12Q1/683C12Q1/686C12Q1/70C12Q2531/113
Inventor 万春和黄瑜陈红梅施少华傅光华程龙飞
Owner INST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More