Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Expression vector containing green fluorescent protein gene and construction method and application thereof

A technology of green fluorescent protein and expression vector, applied in the biological field, can solve the problem of time-consuming and laborious, and achieve the effect of accurate screening

Inactive Publication Date: 2014-03-26
CUSABIO TECH LLC
View PDF1 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In view of the fact that green fluorescent protein can be used as a reporter gene and is widely used in biotechnology, but the existing expression vector with the gene fragment of the target protein needs to go through the steps of picking colonies and gene sequencing to determine whether it is the correct positive Clones require a lot of blind spot picking and PCR identification, which is time-consuming and labor-intensive

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Expression vector containing green fluorescent protein gene and construction method and application thereof
  • Expression vector containing green fluorescent protein gene and construction method and application thereof
  • Expression vector containing green fluorescent protein gene and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Construction of expression vector pET-28a(+)-sfGFP containing sfGFP gene

[0027] ① Preparation of plasmid pET-28a(+)

[0028] Escherichia coli containing plasmid pET-28a(+) was cultured on LB (containing 50 mg / L kanamycin) solid medium at 37°C for 12 hours. Pick a single colony of Escherichia coli containing the plasmid pET-28a(+) from the culture medium, and transfer it to LB (containing 50 mg / L kanamycin) liquid medium, and place it on a shaker at 250 rpm at 37 Under the condition of ℃, culture in suspension for 12 hours. Finally, the plasmid pET-28a(+) was extracted with a plasmid extraction kit from Sangon Company, and the obtained plasmid was stored at -20°C for future use.

[0029] ② Construction of expression vector pET-28a(+)-sfGFP containing sfGFP gene

[0030] 1) Synthesize the sfGFP gene sequence of SEQ ID NO:1;

[0031] 2) In primer 1: 5'ACGCGTCGACTGATGTCCAAAGGAGAAGAGC3'

[0032] Primer 2: 5'ATGCGCGGCCGCTTACTTGTACAGCTCGT3'

[0033] Under the guidance ...

Embodiment 2

[0037] Example 2 Construction of the expression vector pGEX-6P-1-sfGPF containing the sfGFP gene

[0038] ① Preparation of plasmid pGEX-6P-1

[0039] Escherichia coli containing plasmid pGEX-6P-1 was cultured on LB (containing 50 mg / L ampicillin) solid medium at 37°C for 12 hours. Pick a single colony of Escherichia coli containing the plasmid pGEX-6P-1 from the culture medium, and transfer it to LB (containing 50 mg / L ampicillin) liquid medium, and place it on a shaker at 250 rpm at 37°C , suspension culture for 12 hours. Finally, the plasmid pGEX-6P-1 was extracted with a plasmid extraction kit from Sangon Company, and the obtained plasmid was stored at -20°C for future use.

[0040] ② Construction of expression vector pGEX-6P-1-sfGFP containing sfGFP gene

[0041] 1) Synthesize the sfGFP gene sequence of SEQ ID NO:1;

[0042]2) In primer 1: 5'ACGCGTCGACTGATGTCCAAAGGAGAAGAGC3'

[0043] Primer 2: Under the guidance of 5'ATGCGCGGCCGCTTACTTGTACAGCTCGT3', use the sfGFP gene...

Embodiment 3

[0047] Example 3 Construction of expression vector pET-28a(+)-β2M using plasmid pET-28a(+)-sfGFP

[0048] ① Preparation of plasmid pET-28a(+)-sfGFP

[0049] Escherichia coli containing plasmid pET-28a(+)-sfGFP was cultured on LB (containing 50 mg / L kanamycin) solid medium at 37°C for 12 hours. Pick a single colony of Escherichia coli containing the plasmid pET-28a(+)-sfGFP from the culture medium, and transfer it to LB (containing 50 mg / L Kanamyces) liquid medium, and place it on a shaker with a rotation speed of 250rpm Under the condition of 37°C, culture in suspension for 12 hours. Finally, the plasmid pET-28a(+)-sfGFP was extracted with a plasmid extraction kit from Sangon Company, and the obtained plasmid was stored at -20°C for future use.

[0050] ② Construction of expression vector pET-28a(+)-β2M containing β2M gene

[0051] 1) Synthesize the β2M gene sequence of SEQ ID NO:3;

[0052] 2) In primer 1: 5'ACGCGTCGACTGATCCAGCGTACTCCAAAG3'

[0053] Primer 2: 5'ATGCGCGGC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to an expression vector containing a green fluorescent protein gene. The green fluorescent protein gene is a gene sfGFP, wherein the nucleotide sequence of the gene sfGFP is shown in SEQ ID NO: 1. The invention further relates to a construction method of the expression vector containing the green fluorescent protein gene and application of the expression vector containing the green fluorescent protein gene in positive clone screening. According to the expression vector containing the green fluorescent protein gene and the construction method and application thereof, the characteristic that the sfGFP can complete super-folding and illuminate under various conditions is utilized, the advantages of luminous power and luminous intensity of the sfGFP are obviously stronger than those of ordinary proteins, such as GFP (Green Fluorescent Protein), EGFP (Enhanced Green Fluorescent Protein) and the like, and are 1.6 times the EGFP, and obvious green fluorescent light can be observed by unaided eyes, so that the screening of positive clones during protein expressed cloning can be facilitated, and the fast and accurate screening for the positive clones is facilitated.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to an expression vector containing a green fluorescent protein gene and its construction method and application. Background technique [0002] Green fluorescent protein, with a molecular weight of about 28kDa, is composed of 238 amino acids, and the 65th-67th amino acid (Ser-Tyr-Gly) forms a luminescent group, which is linked by a covalent bond to become a hydroxybenzyl imidazolidinone, which can It is excited by light to produce fluorescence, which is the main luminescent position. The shape of the green fluorescent protein molecule is cylindrical, like a bucket, and the luminescent group is located in the center of the bucket. Therefore, it can be compared to a "paint bucket" filled with pigments. The formation of its luminophore is not specific, the fluorescence emitted is stable, and it does not need to rely on other substrates to emit light. [0003] Green fluorescent protein (GF...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/70C12N15/65C12N15/66C12N15/64
Inventor 华权高马峰易汪雪沈鹤霄余文祥黄林舒芹
Owner CUSABIO TECH LLC
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com