Expression vector containing green fluorescent protein gene and construction method and application thereof
A technology of green fluorescent protein and expression vector, applied in the biological field, can solve the problem of time-consuming and laborious, and achieve the effect of accurate screening
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Construction of expression vector pET-28a(+)-sfGFP containing sfGFP gene
[0027] ① Preparation of plasmid pET-28a(+)
[0028] Escherichia coli containing plasmid pET-28a(+) was cultured on LB (containing 50 mg / L kanamycin) solid medium at 37°C for 12 hours. Pick a single colony of Escherichia coli containing the plasmid pET-28a(+) from the culture medium, and transfer it to LB (containing 50 mg / L kanamycin) liquid medium, and place it on a shaker at 250 rpm at 37 Under the condition of ℃, culture in suspension for 12 hours. Finally, the plasmid pET-28a(+) was extracted with a plasmid extraction kit from Sangon Company, and the obtained plasmid was stored at -20°C for future use.
[0029] ② Construction of expression vector pET-28a(+)-sfGFP containing sfGFP gene
[0030] 1) Synthesize the sfGFP gene sequence of SEQ ID NO:1;
[0031] 2) In primer 1: 5'ACGCGTCGACTGATGTCCAAAGGAGAAGAGC3'
[0032] Primer 2: 5'ATGCGCGGCCGCTTACTTGTACAGCTCGT3'
[0033] Under the guidance ...
Embodiment 2
[0037] Example 2 Construction of the expression vector pGEX-6P-1-sfGPF containing the sfGFP gene
[0038] ① Preparation of plasmid pGEX-6P-1
[0039] Escherichia coli containing plasmid pGEX-6P-1 was cultured on LB (containing 50 mg / L ampicillin) solid medium at 37°C for 12 hours. Pick a single colony of Escherichia coli containing the plasmid pGEX-6P-1 from the culture medium, and transfer it to LB (containing 50 mg / L ampicillin) liquid medium, and place it on a shaker at 250 rpm at 37°C , suspension culture for 12 hours. Finally, the plasmid pGEX-6P-1 was extracted with a plasmid extraction kit from Sangon Company, and the obtained plasmid was stored at -20°C for future use.
[0040] ② Construction of expression vector pGEX-6P-1-sfGFP containing sfGFP gene
[0041] 1) Synthesize the sfGFP gene sequence of SEQ ID NO:1;
[0042]2) In primer 1: 5'ACGCGTCGACTGATGTCCAAAGGAGAAGAGC3'
[0043] Primer 2: Under the guidance of 5'ATGCGCGGCCGCTTACTTGTACAGCTCGT3', use the sfGFP gene...
Embodiment 3
[0047] Example 3 Construction of expression vector pET-28a(+)-β2M using plasmid pET-28a(+)-sfGFP
[0048] ① Preparation of plasmid pET-28a(+)-sfGFP
[0049] Escherichia coli containing plasmid pET-28a(+)-sfGFP was cultured on LB (containing 50 mg / L kanamycin) solid medium at 37°C for 12 hours. Pick a single colony of Escherichia coli containing the plasmid pET-28a(+)-sfGFP from the culture medium, and transfer it to LB (containing 50 mg / L Kanamyces) liquid medium, and place it on a shaker with a rotation speed of 250rpm Under the condition of 37°C, culture in suspension for 12 hours. Finally, the plasmid pET-28a(+)-sfGFP was extracted with a plasmid extraction kit from Sangon Company, and the obtained plasmid was stored at -20°C for future use.
[0050] ② Construction of expression vector pET-28a(+)-β2M containing β2M gene
[0051] 1) Synthesize the β2M gene sequence of SEQ ID NO:3;
[0052] 2) In primer 1: 5'ACGCGTCGACTGATCCAGCGTACTCCAAAG3'
[0053] Primer 2: 5'ATGCGCGGC...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 