Plasmid vector of escherichia coli secretory expression heterologous protein and establishment method of plasmid vector
A technology for expressing plasmids and foreign proteins, which is applied in the field of protein expression and purification, and can solve problems such as limited protein production, cost consumption, and difficulty in redispersing
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0019] The specific implementation manners of the present invention will be further described in detail below in conjunction with the drawings and embodiments. The following examples will help to illustrate the invention without limiting it in any way.
[0020] 1. Construction of pET22b-PhoA
[0021] Design upstream primers pET22b_phoA-S:
[0022] GGAATTCCATATGAAACAAAGCACTATTGC (5'-3') (SEQ ID NO.1), and downstream primer pET22b_phoA-AS:
[0023] CATGCCATGGCTCCCTGAAAATACAGGTTTTCGGCTTTTGTCACA GGG(5'-3') (SEQ ID NO.2), the PhoA signal peptide gene sequence was amplified with the PhoA gene template, except for the corresponding matching sequence of the PhoA signal peptide, the upstream primer had an NdeI restriction site ( Corresponding enzyme cutting protection bases are connected), the downstream primer has NcoI restriction site (connecting the protection bases), and the TEV enzyme recognition cleavage sequence. The amplified PhoA gene sequence was operated according to the ...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com