Plasmid vector of escherichia coli secretory expression heterologous protein and establishment method of plasmid vector

A technology for expressing plasmids and foreign proteins, which is applied in the field of protein expression and purification, and can solve problems such as limited protein production, cost consumption, and difficulty in redispersing

Active Publication Date: 2014-06-04
FUJIAN INST OF RES ON THE STRUCTURE OF MATTER CHINESE ACAD OF SCI
View PDF8 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The disadvantage is that the expressed foreign protein is limited to the inside of the cell. Due to the limited space, the protein yield of the soluble part is limited, and many proteins form aggregation or inclusion bodies in the cell, which requires further denaturation and renaturation t

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plasmid vector of escherichia coli secretory expression heterologous protein and establishment method of plasmid vector
  • Plasmid vector of escherichia coli secretory expression heterologous protein and establishment method of plasmid vector
  • Plasmid vector of escherichia coli secretory expression heterologous protein and establishment method of plasmid vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0019] The specific implementation manners of the present invention will be further described in detail below in conjunction with the drawings and embodiments. The following examples will help to illustrate the invention without limiting it in any way.

[0020] 1. Construction of pET22b-PhoA

[0021] Design upstream primers pET22b_phoA-S:

[0022] GGAATTCCATATGAAACAAAGCACTATTGC (5'-3') (SEQ ID NO.1), and downstream primer pET22b_phoA-AS:

[0023] CATGCCATGGCTCCCTGAAAATACAGGTTTTCGGCTTTTGTCACA GGG(5'-3') (SEQ ID NO.2), the PhoA signal peptide gene sequence was amplified with the PhoA gene template, except for the corresponding matching sequence of the PhoA signal peptide, the upstream primer had an NdeI restriction site ( Corresponding enzyme cutting protection bases are connected), the downstream primer has NcoI restriction site (connecting the protection bases), and the TEV enzyme recognition cleavage sequence. The amplified PhoA gene sequence was operated according to the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a plasmid vector of escherichia coli secretory expression heterologous protein and an establishment method of the plasmid vector, and in particular discloses a recombinant secreting type expression vector. The vector comprises an alkaline phosphatase PhoA secretory signal peptide and multi-poly histidine sequence, and can express the heterologous recombinant protein through IPTG (Psopropyl-beta-d-Thiogalactoside) induction in escherichia coli BL21. The invention further discloses techniques for establishment of the vector, PhoA induced peptide-heterologous protein fusion gene clone and fusion protein expression and detection. As the heterologous protein is enabled to be stably expressed in an extracellular manner, the vector can be applied to secretory expression of ordinary protein.

Description

technical field [0001] The invention relates to the technical field of protein expression and purification, in particular to a plasmid vector for secreting and expressing foreign proteins and a construction method thereof. technical background [0002] Protein expression and purification technology has important applications in many fields such as low-cost extraction of enzymes and active proteins, protein function research, and protein structure analysis. The most basic requirement for the purified protein is that the protein can be well dispersed in the corresponding solution and have good biological activity. At present, most of the conventional expression vectors are based on the intracellular expression technology of E. coli, which has the advantage that E. coli is easy to cultivate and disrupt, which is beneficial to the purification of proteins. The disadvantage is that the expressed exogenous protein is limited to the inside of the cell, and the protein yield of the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/70C12N1/21C12N15/66G01N27/447C12R1/19
Inventor 吴允昆张蕾孙丽芳赵艳和吴秀玲
Owner FUJIAN INST OF RES ON THE STRUCTURE OF MATTER CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap