Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of a kind of Candida albicans cafun30 gene and the attenuated strain of Candida albicans with deletion of cafun30 gene

A technology of Candida albicans and attenuated strains, applied in the field of genetic engineering, can solve the problems of unclear regulation mechanism and in-depth research, and achieve the effect of reducing efficiency and reducing toxicity

Active Publication Date: 2017-02-22
CENT FOR EXCELLENCE IN MOLECULAR CELL SCI CHINESE ACAD OF SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are still those proteins involved in the regulatory network of Wor1, and the research is not very in-depth, and the regulatory mechanism is not very clear.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of a kind of Candida albicans cafun30 gene and the attenuated strain of Candida albicans with deletion of cafun30 gene
  • Application of a kind of Candida albicans cafun30 gene and the attenuated strain of Candida albicans with deletion of cafun30 gene
  • Application of a kind of Candida albicans cafun30 gene and the attenuated strain of Candida albicans with deletion of cafun30 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] The construction of the ectopic overexpression strain of embodiment 1 Candida albicans CaFUN30 gene

[0050] Since the FUN30 gene in Candida albicans is a new gene with unknown function, and we obtained the protein that can interact with Wor1 by screening the yeast two-hybrid library, in order to detect whether CaFUN30 is also present in the white-gray form of Candida albicans To function during transformation, we first constructed a plasmid overexpressing FUN30. The overexpression CaFUN30 plasmid was constructed on the BA1 vector, located downstream of the ADH1 promoter, with Ade2 homologous recombination arms at both ends (the homology arm is contained in the BA1 vector) (see Cao.et al., 2006 for the construction method of the BA1 vector. Mol Biol Cell 17:295-307.). Use the CGD website (http: / / www.candidagenome.org / ) to search for the full-length sequence (SEQ ID NO: 1) of the FUN30 gene in Candida albicans, and then design primers

[0051] FUN30F: 5'ccgAGATCTATGAGT...

Embodiment 2

[0057] Construction of the knockout strain of embodiment 2 Candida albicans CaFUN30 gene

[0058] In order to more comprehensively study the regulatory function of CaFUN30 in the morphological transformation of white ash, we constructed a CaFUN30 gene knockout strain in Candida albicans. Using 5-FOA to knock out the URA3 in the hisG-URA3-hisG fragment, the gene is knocked out, and the positive clones that complement the auxotrophy are screened. First find the upstream and downstream gene sequences of FUN30 on CGD, and design primers to amplify by PCR method:

[0059] Primer Fun30UF: 5'ccc AAGCTTGTCTTTTATGGAACTTCC3' (SEQ ID NO: 3)

[0060] Primer Fun30UR: 5'ccgGGATCCTTGAATGAAAATAAGTAATACCAGC3' (SEQ ID NO: 4)

[0061] A 533bp upstream homology arm was amplified.

[0062] Primer FUN30DF: 5' cccGGTACCACAAAATAAGAAATGTACCACATTTGAAGCTG3' (SEQ ID NO: 5)

[0063] Primer FUN30DR: 5'ccgGAATTCAATACTGTCAATCCACCACCC3' (SEQ ID NO: 6)

[0064] A 366bp downstream homology arm was amplified....

Embodiment 3

[0070] The effect of overexpression and deletion of embodiment 3 CaFUN30 gene on the morphological transition of Candida albicans

[0071] The CaFUN30 gene of Candida albicans was knocked out by homologous recombination method, and the correct knockout strain of fun30 / fun30 was identified by PCR method and Southern method ( Figure 1B ,1C). This also shows that the knockout of FUN30 gene will not lead to the death of Candida albicans.

[0072] In order to prove the function of FUN30 gene in the morphological transformation of white and gray, we conducted a series of morphological transformation experiments and statistical data. Streak the strains of various genotypes from the library onto a fresh YPD plate, culture them at 22°C for two days, then pick about one Colony-sized strain and dilute it in 1ml ddH 2 O, measure OD 600 value (OD 600 =0.1, the concentration of cells is 3×10 6 cell / ml). Then perform 100-fold concentration gradient dilution, take 100-200ul cell suspen...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of gene engineering, especially to an application of candida albicans CaFUN30 gene and a candida albicans attenuated strain with deletion of the CaFUN30 gene. According to the application of the candida albicans CaFUN30 gene, the candida albicans CaFUN30 gene is used in preparation of the candida albicans attenuated strain or used in preparation or screening of a candida albicans medicine. According to the invention, the candida albicans attenuated strain is successfully established, and a construction method of the candida albicans attenuated strain is further provided. In the attenuated strain, the CaFUN30 gene is not expressed, and white-grey phenotype switching efficiency of the candida albicans attenuated strain is greatly reduced in comparison with wild type candida albicans so as to decrease toxicity of candida albicans.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to an application of the CaFUN30 gene of Candida albicans and an attenuated strain of Candida albicans lacking the CaFUN30 gene. Background technique [0002] Candida albicans (Candida albicans) is an opportunistic human pathogenic fungus isolated clinically. It can cause extensive superficial and Deep system infection, the infection site includes the oral cavity, female vagina, etc., causing thrush, vaginitis, etc., can also invade the epidermis and endothelial cells into the blood and reach internal organs, such as kidneys, brain, etc., leading to sepsis, and severe cases can lead to death ( Odds, F.C. 1994. J. Am. Acad, Dermatol. 31:S2-S5.). Candida albicans has different growth forms under different growth conditions, including yeast form, pseudohyphae, hyphae, white cell, and opaque cell. This morphological transformation ability directly affects the pathogenicity of Candid...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/16C12N15/09C12Q1/02C12R1/725
Inventor 陈江野高宁聂鑫怡王华峰鄢明辉
Owner CENT FOR EXCELLENCE IN MOLECULAR CELL SCI CHINESE ACAD OF SCI