Supercharge Your Innovation With Domain-Expert AI Agents!

Rapid identification method of Rhizoma Acori Calami

An identification method and a technique for Tibetan calamus, applied in the field of identification of Chinese medicinal materials source varieties, can solve the problems of the same name foreign body, identification obstacles, the same thing with different names, etc., and achieve the effect of accurate identification and wide applicability

Inactive Publication Date: 2015-04-01
INST OF MEDICINAL PLANT DEV CHINESE ACADEMY OF MEDICAL SCI
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, the names of Tibetan calamus, water calamus, and stone calamus are confusing in the medicinal material market, and there are phenomena of the same thing with different names and the same name with different things.
In view of the difficulty in identifying Tibetan calamus and its related species through traditional character identification, it is more difficult to identify Tibetan calamus slices that exist in the medicinal material market.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rapid identification method of Rhizoma Acori Calami
  • Rapid identification method of Rhizoma Acori Calami
  • Rapid identification method of Rhizoma Acori Calami

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] The identification method of embodiment 1 Tibetan Calamus medicinal material raw material

[0027] 1) 21 samples of Tibetan Acorus and 25 samples of Acorus iris collected from different origins and botanical gardens, among which about 40 mg of rhizomes and about 20 mg of leaves were ground on a MM400 ball mill (Retsch, Germany), and Tiangen Biochemical Total DNA was extracted with the Plant Genomic DNA Kit of Science and Technology (Beijing) Co., Ltd.

[0028] Table 1 Information table of Tibetan calamus samples

[0029]

[0030]

[0031] 2) PCR amplification

[0032] The primer sequence is ITS2F: ATGCGATACTTGGTGTGAAT; ITS3R: GACGCTTCTCCAGACTACAAT, synthesized by Shanghai Sangon Biotechnology Co., Ltd. (Beijing). Primers were dissolved in sterile deionized and diluted to 2.5 μmol / μL.

[0033] 25μL reaction system: PCR Buffer (10×) 2.5μL, Mg 2+ 2 μL (25 mmol / L), 2 μL (2.5 mmol / L) of dNTPs mixture, 1.0 μL (2.5 μmol / L) of each primer, 2 μL (~30 ng) of template DN...

Embodiment 2

[0043] Identification of embodiment 2 Tibetan calamus decoction pieces

[0044] It is basically the same as in Example 1, except that Tibetan calamus decoction pieces are used as a sample, DNA is extracted and identified, and the above two SNPs can also be specifically detected as a result. And sequence comparison found that the 23rd position of the ITS2 intergenic region sequence (SEQ ID No.1) of the DNA of Tibetan calamus decoction pieces is C, and the 212th position is G.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a rapid identification method of Rhizoma Acori Calami. The method comprises the following steps: 1) DNA of a sample to be tested is used as a template, and fragments containing sequence as shown in SEQ ID No.1 are amplified; and 2) amplification products are sequenced, and the sequence as shown in SEQ ID No.1 is analyzed; if the 23rd site from 5' end of the sequence as shown in SEQ ID No.1 is C and / or the 212th site is G, the sample is identified as Rhizoma Acori Calami; and if the 23rd site from 5' end of the sequence as shown in SEQ ID No.1 is T and the 212th site is C or T, the sample to be identified is not Rhizoma Acori Calami. By the above method, rapid and accurate identification of the Rhizoma Acori Calami orginal plant and its sibling species, medicinal materials, raw medicinal slices and adulterants can be realized.

Description

technical field [0001] The invention belongs to the technical field of identification of source varieties of traditional Chinese medicinal materials, and in particular relates to a method for identifying Tibetan calamus with specific SNPs loci. Background technique [0002] Tibetan calamus (Acorus calamus L.) is a perennial herbaceous plant of the genus Calamus in the family Araceae, distributed in Asia, Europe and North America. As a traditional Tibetan medicinal material, Tibetan calamus has various pharmacological effects such as insect repellent, antibacterial, fat reduction, anticancer, antidiabetic, anti-inflammatory, immune regulation, expectorant, radiation protection, etc., and also has obvious effects on the digestive system and nervous system . However, its toxicity should not be underestimated. As the active ingredients, β-asarone and α-asarone have "three causes" (carcinogenic, teratogenic, and mutagenic) toxicity. Because of this, the U.S. FDA (Food and Drug ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/11C12Q1/68
Inventor 陈士林韩建萍王丽丽宋经元
Owner INST OF MEDICINAL PLANT DEV CHINESE ACADEMY OF MEDICAL SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More