Rapid identification method of Rhizoma Acori Calami
An identification method and a technique for Tibetan calamus, applied in the field of identification of Chinese medicinal materials source varieties, can solve the problems of the same name foreign body, identification obstacles, the same thing with different names, etc., and achieve the effect of accurate identification and wide applicability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] The identification method of embodiment 1 Tibetan Calamus medicinal material raw material
[0027] 1) 21 samples of Tibetan Acorus and 25 samples of Acorus iris collected from different origins and botanical gardens, among which about 40 mg of rhizomes and about 20 mg of leaves were ground on a MM400 ball mill (Retsch, Germany), and Tiangen Biochemical Total DNA was extracted with the Plant Genomic DNA Kit of Science and Technology (Beijing) Co., Ltd.
[0028] Table 1 Information table of Tibetan calamus samples
[0029]
[0030]
[0031] 2) PCR amplification
[0032] The primer sequence is ITS2F: ATGCGATACTTGGTGTGAAT; ITS3R: GACGCTTCTCCAGACTACAAT, synthesized by Shanghai Sangon Biotechnology Co., Ltd. (Beijing). Primers were dissolved in sterile deionized and diluted to 2.5 μmol / μL.
[0033] 25μL reaction system: PCR Buffer (10×) 2.5μL, Mg 2+ 2 μL (25 mmol / L), 2 μL (2.5 mmol / L) of dNTPs mixture, 1.0 μL (2.5 μmol / L) of each primer, 2 μL (~30 ng) of template DN...
Embodiment 2
[0043] Identification of embodiment 2 Tibetan calamus decoction pieces
[0044] It is basically the same as in Example 1, except that Tibetan calamus decoction pieces are used as a sample, DNA is extracted and identified, and the above two SNPs can also be specifically detected as a result. And sequence comparison found that the 23rd position of the ITS2 intergenic region sequence (SEQ ID No.1) of the DNA of Tibetan calamus decoction pieces is C, and the 212th position is G.
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com