hmg1 Gene and Its Application in Molecular Detection of Microsporidium Bombyx mori

A technology of microsporidia and silkworm, which is applied in application, genetic engineering, plant genetic improvement, etc., can solve the problems of low primer sensitivity, low sensitivity, detection interference, etc., and achieve the effects of wide application range, convenient use, and increased range

Active Publication Date: 2017-04-12
SOUTH CHINA AGRI UNIV
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Most of the target genes of the primers designed in the research of silkworm microsporidian PCR detection technology are also SSUrRNA, and the primers designed for other microsporidian genes are less or have poor sensitivity, so they are rarely reported
Baker et al (1995) and Terry et al (1999) designed PCR primer V1f / 530r based on the highly conserved region of SSU rRNA of similar species of Microsporidia, which can identify DNA templates of various species of Microsporidia and amplify about 450bp Specific target bands, but not specific to Bombyx mori Microsporidia, and the inventors found that using this primer to detect silkworm egg Microsporidia, the detection sensitivity is extremely low, suggesting that there may be a certain Inhibitory factors interfere with PCR amplification of DNA from No.
On the other hand, microsporidia parasitize in silkworm eggs, and the content of silkworm eggs is significantly higher than that of the microsporidia to be detected. In the extracted DNA samples, both DNAs exist at the same time, and the DNA of silkworm silkworm eggs seriously affects the detection. Interference, therefore, if you want to directly use silkworm egg DNA as a template for the detection of microsporidia, higher requirements are put forward for the detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • hmg1 Gene and Its Application in Molecular Detection of Microsporidium Bombyx mori
  • hmg1 Gene and Its Application in Molecular Detection of Microsporidium Bombyx mori
  • hmg1 Gene and Its Application in Molecular Detection of Microsporidium Bombyx mori

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1 The HMG1 gene of the silkworm Microsporidia

[0040] 1. According to the method of gene homologous cloning in the gene cloning technology of molecular biology, the full-length cDNA and DNA sequences of the HMG 1 gene of N. silkworm were cloned.

[0041] 2. Obtaining the full length of cDNA, the specific method is as follows:

[0042] (1) Using Primer premier 5.0 software, combined with comprehensive analysis, the primers primers HMG1F / HMG1R were designed, and the sequences are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively.

[0043] Upstream primer HMG1F (SEQ ID NO.3):

[0044] 5' ATGACTGCTCAAAAAGACGATAC 3'

[0045] Downstream primer HMG1R (SEQ ID NO.4):

[0046] 5'TTATTCATCACTATTCTCCTACTTCT 3'.

[0047] (2) Using the purified spore DNA of N.b. silkworm (N.b) as a template, PCR amplification was performed with primers HMG1F / HMG1R.

[0048] (3) The PCR product was purified, connected to pMD19T, and transformed into E, coli DH-5α for culture.

[0049] ...

Embodiment 2

[0053] Example 2 Detection primer design and establishment of PCR amplification method

[0054] 1. Primer design

[0055] On the basis of obtaining the HMG 1 gene of Bombyx mori, the Primer Premier 5.0 software was used to design multiple pairs of primers. After a large number of drug resistance, specificity and sensitivity tests, three pairs of primers were finally selected as representative primers. The primer sequences of each group are as follows:

[0056] (1) The first pair:

[0057] Upstream primer HMG1F (SEQ ID NO.3):

[0058] 5' ATGACTGCTCAAAAAGACGATAC 3'

[0059] Downstream primer HMG1R (SEQ ID NO.4):

[0060] 5'TTATTCATCACTATTCTCCTACTTCT 3'.

[0061] (2) The second pair:

[0062] Upstream primer HMG1-sF (SEQ ID NO.5):

[0063] TTCCGAAATAATCTTCTTTTAATTG

[0064] Downstream primer HMG1-sR (SEQ ID NO.6):

[0065] TTGTGCACCGAATCGTAAATAG

[0066] (3) The third pair:

[0067] Upstream primer HMG1-xF (SEQ ID NO.7):

[0068] TCCCTAGGAACTTTTAAAGAGAAG

[0069] Dow...

Embodiment 3

[0091] Example 3 Primer-specific detection

[0092] 1. The DNA of Microsporidia Bombyx (N.b), Microsporidia tussah (N.a), and Microsporidia corn borer (N.f) were used as templates, and the primers HMG1F / HMG1R, HMG1-sF / HMG1-sR, HMG1-xF / HMG1-xR, PCR amplification was carried out by the method of Example 2, and the results were detected by agarose gel electrophoresis after the amplification.

[0093] 2. The amplification results of the three pairs of primers are shown in the attached Figure 4~6 shown. The results showed that only the primer HMG1-sF / HMG1-sR could specifically detect Bombyx mori Microsporidia, while the primers HMG1F / HMG1R and HMG1-xF / HMG1-xR could detect all the microsporidia, and had good generality. Detectable, but not specific for Microsporidia Bombyx mori.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a silkworm microsporidia HMG1 gene as well as a specific primer set used for rapidly detecting silkworm microsporidia and application thereof. The primer set comprises an upstream primer HMG1-s and a downstream primer HMG1-sR, wherein a nucleotide sequence of the upstream primer is shown in SEQ ID No.5, and a nucleotide sequence of the lower primer is shown in SEQ ID NO.6. A target gene of the detection primer is a high mobility protein gene HMG1 related to sex of the silkworm microsporidia, when the high mobility protein gene HMG1 is taken as the target gene for a silkworm tissue, especially silkworm egg microsporidia molecular detection, the characteristics of reliable detection result, easy operation, strong specificity and high sensitivity can be realized, and the high mobility protein gene HMG1 can be applied to high-sensitivity and rapid silkworm microsporidia molecular detection, especially early detection of the silkworm microsporidia, and has great significance in practical application.

Description

technical field [0001] The invention belongs to the technical field of insect pathogenic microorganism molecular detection. More specifically, it relates to HMG1 gene and its application in the molecular detection of silkworm Microsporidia. Background technique [0002] The study of silkworm microparticle disease (also known as silkworm microsporidiosis) began with a nationwide epidemic of microparticle disease in France in 1845. Pasteur determined that the "microparticles" he observed were the causative factor for microparticle disease, which Balbiani later identified as Bombyx mori Nosema bombycis (J.V. Maddox et al., 2000). Silkworm Microsporidia has two modes of infection: horizontal transmission and vertical transmission, among which vertical transmission causes great harm to the production of silkworm seeds in sericulture production, and at the same time has a great negative impact on the yield and quality of silk cocoons for breeding silkworms. Influence the develop...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/30C12Q1/68C12N15/11
CPCY02A50/30
Inventor 刘吉平宋小景程伟
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap