Check patentability & draft patents in minutes with Patsnap Eureka AI!

PhoP deleted riemerella anatipestifer CH1 attenuated strain and construction method thereof

A technology of Riemerella anatipestifer and a construction method is applied in the field of Riemerella anatipestifer CH1 attenuated strain and construction, and can solve the problems of unsatisfactory, incomplete coverage of virus strains, and no report of attenuated strains.

Inactive Publication Date: 2015-04-29
SICHUAN AGRI UNIV
View PDF2 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these vaccines have defects: for example, the widely used inactivated oil emulsion vaccine cannot provide complete protection (about 70% protection rate), and there are problems such as poor injection absorption and incomplete strain coverage. The duck infectious serositis vaccine of various serotypes has become an urgent need for the development of poultry industry in my country
Globally regulated genes in Riemerella anatipestifer phoP Research not yet reported
There is no report in the prior art on the phoP Whether transformation can obtain attenuated strain

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • PhoP deleted riemerella anatipestifer CH1 attenuated strain and construction method thereof
  • PhoP deleted riemerella anatipestifer CH1 attenuated strain and construction method thereof
  • PhoP deleted riemerella anatipestifer CH1 attenuated strain and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] Preparation of Riemerella anatipestifer (RA-CH1) attenuated strain:

[0062] The Riemerella anatipestifer was preserved in the Poultry Disease Center Laboratory of Sichuan Agricultural University (RA-CH1), and the Salmonella was Salmonella typhimurium UK-1 ( x3761 ), Escherichia coli is Escherichia coli engineering bacteria, such as c7232, c7213, c6212 and so on.

[0063] In the first step, Riemerella anatipestifer serotype 1 (RA-CH1) latent phoP Functional identification of genes based on Salmonella typhimurium UK-1 strain phoP Sequence comparison using BLASTP found that there are two potential in RA-CH1 phoP gene sequence, named phoP1 and phoP2 . Design primers:

[0064] phoP1 for:

[0065] phoP1- F: CATGCCATGGTGAGCAACAGGATATTAT

[0066] phoP 1-R: CGCGGATCCATTTTTAACTAGAAGCCT

[0067] phoP2 for:

[0068] phoP 2-F: CATGCCATGGTGCAAAAAATATTAATTG

[0069] phoP 2-R: CGCGGATCCTTTTTTAACAAAGTTGGAA

[0070] After the sequence was amplified, it was dig...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a riemerella anatipestifer CH1 global regulator phoP attenuated strain and a construction method thereof, and belongs to the technical field of biological engineering. The attenuated strain is constructed by knocking out a phoP gene by means of a homologous recombination method and utilizing a bacterial conjugation method. The prepared attenuated strain has a preservation number of CCTCC NO:M2014557, and is preserved on November 7, 2014. The attenuated strain has low toxicity, and a foundation is established for construction of subsequent vaccine vectors and construction of a riemerella anatipestifer gene regulatory network. The invention further provides application of the attenuated strain in vaccines.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, in particular to deletion phoP Riemerella anatipestifer CH1 attenuated strain and its construction method. Background technique [0002] Riemerella anatipestifer ( Riemerella anatipestifer, RA) mainly causes infectious serositis, which affects various poultry including ducklings and geese, manifested as acute or chronic, septic, and contact infectious diseases. The main prevalent serotypes in my country are serotype 1, 2 and 10. Duck infectious serositis mainly occurs in ducklings aged 10-35 days. The incidence rate can reach more than 90%, and the mortality rate is 5%-75%. economic loss. At present, the prevention and treatment of Riemerella anatipestifer mainly relies on antibiotic treatment. However, with the continuous increase of multi-drug resistance and the consideration of food safety and other issues, vaccine immunization is the most economical and effective way ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12N15/74A61K39/02A61P31/04C12R1/01
CPCA61K39/00C07K14/195
Inventor 孔庆科张洁刘青赵新新
Owner SICHUAN AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More