Method for establishing plasmid capable of knocking out mouse CRAMP gene by use of TALEN technique

A gene and mouse technology, applied in the field of constructing knockout mouse CRAMP gene plasmids, to achieve the effect of high transfection efficiency, short cycle and accurate targeted knockout

Inactive Publication Date: 2015-06-10
SHANGHAI TONGJI HOSPITAL
View PDF8 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] There are no reports on the TALEN recognition sequence and plasmid for targeted knockout of mouse CRAMP gene and the method of using TALEN technology to target knockout of mouse CRAMP gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for establishing plasmid capable of knocking out mouse CRAMP gene by use of TALEN technique
  • Method for establishing plasmid capable of knocking out mouse CRAMP gene by use of TALEN technique
  • Method for establishing plasmid capable of knocking out mouse CRAMP gene by use of TALEN technique

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0034] The procedure of TALEN plasmid construction and activity identification in this embodiment is shown in figure 1 .

[0035] 1. Construction of TALEN prokaryotic expression vector capable of knocking out CRAMP gene.

[0036] (1) NCBI downloaded the mouse CRAMP genome sequence (SEQ ID NO.3) and selected the target. target sequence:

[0037] atgcagttccagagggacgtcccctccctgtggctgtggcggtcactatcactgctgctgctactgggcctggggtctcccagaccccagctacagggatgctgtgctccgagctgtggatgacttcaaccagcagtccctagacaccaatctctaccgtctcctggacctggatcctgagccccaaggg.

[0038] (2) According to the TALENs design principle, design in the TALENs sequence design software (https: / / tale-nt.cac.cornell.edu), find the CDS region of the CRAMP gene from the example table, and design the corresponding TALEN left arm 3 recognition sequences, 2 TALEN right arm recognition sequences. See the design results figure 2 and Table 1.

[0039]Table 1 Design of left and right arms of CRAMP gene CDS1TALENs

[0040] na...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a TALEN recognition sequence pair for directionally knocking out a mouse cell CRAMP gene and a carrier plasmid established by use of the recognition sequences. The gene sequences of the TALEN recognition sequence pair are as shown in SEQ ID NO. 9 and SEQ ID NO. 12, respectively. The carrier plasmid comprises a TALEN chain L and a TALEN chain R; the TALEN chain L is encoded by the bases of the sequence as shown in SEQ ID NO. 1, and the TALEN chain R is encoded by the bases of the sequence as shown in SEQ ID NO. 2. The invention also discloses a preparation method of an endogenous CRAMP gene knockout cell; the nucleotide sequences encoding the TALEN chain L and the TALEN chain R are inserted into prokaryotic expression vectors, respectively, before transfection into the cell containing the endogenous CRAMP gene, and then the endogenous CRAMP gene knockout cell can be obtained.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a method for constructing a knockout mouse CRAMP gene plasmid using TALEN technology. Background technique [0002] How to carry out precise and efficient targeted modification of the genome has always been a difficult problem. The theoretical basis of traditional gene targeting technology is the random exchange of homologous chromosomes that occur naturally in cells. The efficiency of gene targeting using this technology is very low, usually only 10 -6 -10 -8 . Sequence-specific nucleases developed rapidly in recent years can be used for precise genome-targeted modification. They are generally fusion proteins consisting of a sequence-specific DNA recognition domain and a non-specific endonuclease domain. The modification mechanism is limited by the DNA recognition domain to position the endonuclease to the genomic region that needs to be edited, and the non-specific endonuclease ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12N15/85C12N15/55C12N15/12C12N5/10A01K67/027
Inventor李冬吴军录权文强
OwnerSHANGHAI TONGJI HOSPITAL