Methods and kits for detecting wild-type and/or mutated target dna sequences
A DNA sequence and kit technology, applied in the field of detecting wild-type and/or mutated target DNA sequences and kits, can solve the problem of not allowing the detection of specific polymorphic sites, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1- 2
[0121] Embodiment 1-bivalent primer method
[0122] Initially tested in the SY5Y cell line (SH-SY5Y ATCC catalog number CRL-2266 TM ) with a heterozygous C to A substitution at codon 1174 of the ALK gene converting phenylalanine to leucine (F1174L); taking into account flanking sequences, the heterozygous substitution was at A new restriction site (RS) was introduced into the mutated allele, whereas the wild-type allele did not have any RS.
[0123] figure 2 is a simplified draft of the sequences and transformations in the WGA DNA library generated by mutagenesis.
[0124] To detect mutations occurring on the RS, the following methods were tested. A universal primer for whole-genome amplification (DRS-WGA primer, SEQ ID NO: 1, having the sequence AGTGGGATTCCTGCTGTCAGT) was developed for the design of the 5' primer in a new PCR primer pair, wherein the 3' primer overlaps the RS by 3 ' in the region.
[0125] This strategy consists of designing bivalent primer pairs cont...
Embodiment 2
[0133] Example 2-Hybrid Primer Consistency Range Limitation
[0134] Amplification tests were performed on the same SY5Y cell line as used in Example 1, but using the method of the present invention.
[0135] To test for amplification of both wild-type (WT) and mutant (M) alleles in DRS-WGA products, DEPArray TM Individual SY5Y cells were isolated, which provided pure single cells.
[0136] An amplification method using a 5' PCR primer whose length 86% matched the WGA universal primer provided a solution that amplified neither the WT nor the M allele. Such as Figure 5 As shown in , the amplification failed to provide clear and specific bands in the mutant (M), wild type (WT) and PCR negative control (C-) samples. The negative control (Ctr-) of the WGA showed only non-specific bands.
[0137] Primers with different percent identity to the WGA universal primers were tested. The results are summarized in Table 1 below.
[0138] Table 1
[0139]
[0140] In Table 1, col...
Embodiment 3
[0142] Embodiment 3 introduces new RS in the mutant allele (ALK gene)—detection method design
[0143] The method according to the invention guarantees amplification (and sequencing) even in the case of incomplete digestion by said restriction endonucleases. In fact, the activity of the restriction endonucleases is not guaranteed for all RSs in the target DNA, and a statistically small percentage of undigested RSs are present in the DRS-WGA, which however are detected by the DRS-WGA Amplification was successful, although the WGA-primer (primary-PCR) was in another RS.
[0144] In the absence of digested sites, the use of the mutation detection method with only one primer pair designed against the mutant sequence will not allow amplification and sequencing of the target.
[0145] Amplification tests were again performed on the SY5Y cell line, which - as previously published - had a heterozygous C to A substitution at codon 1174, converting phenylalanine to leucine (F1174L). ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More