Novel endogenous gene expression substituting lentivirus vector and construction method thereof
A lentiviral vector and endogenous gene technology, applied in the field of novel lentiviral vectors that replace the expression of endogenous genes and their construction, can solve the problems of cumbersome operations, inability to study important roles, inability to obtain interfering or overexpressing intermediates, and the like, To achieve the effect of efficient genetic modification and efficient integration
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0015] The present invention will be further described below in conjunction with accompanying drawing:
[0016] Such as figure 1 As shown, the lentiviral vector pLenti-FlagN-shRNA of the present invention has the following structure: a U6 promoter is inserted in the middle of the lentiviral 5' and 3'LTR for transcription of a shRNA sequence, and the shRNA insertion region (ggatccgcgcggtgaccctcgag) contains BamHI and XhoI double enzymes cutting site, which can be inserted into the annealed shRNA sequence. The EF1a promoter transcribes and expresses the foreign gene fused with the Flag tag, and the Flag tag is fused at the N-terminal of the foreign gene. The multi-cloning site (GTTAACGAATTCGCTAGC) contains three restriction sites of HpaI, EcoRI and NheI for inserting the foreign gene, among which HpaI For blunt-end digestion, any gene can be inserted. IRES (Internal ribosome entry site, IRES), also known as the internal ribosome entry sequence, is used to initiate the expressi...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com