Supercharge Your Innovation With Domain-Expert AI Agents!

Novel endogenous gene expression substituting lentivirus vector and construction method thereof

A lentiviral vector and endogenous gene technology, applied in the field of novel lentiviral vectors that replace the expression of endogenous genes and their construction, can solve the problems of cumbersome operations, inability to study important roles, inability to obtain interfering or overexpressing intermediates, and the like, To achieve the effect of efficient genetic modification and efficient integration

Inactive Publication Date: 2015-07-29
HANGZHOU NIUBEI BIOTECH
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Conventional simple overexpression of artificially modified genes cannot eliminate the interference of endogenous genes, and simple RNA interference cannot study which amino acid plays an important role in the protein
If RNA interference and overexpression of artificially modified genes are carried out at the same time, the conventional method needs to use a two-step method to interfere and overexpress genes successively, and the operation is very cumbersome
Moreover, if the gene is extremely important for cell survival, it is often impossible to obtain interfering or overexpressed intermediate products, making the entire experiment impossible

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel endogenous gene expression substituting lentivirus vector and construction method thereof
  • Novel endogenous gene expression substituting lentivirus vector and construction method thereof
  • Novel endogenous gene expression substituting lentivirus vector and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0015] The present invention will be further described below in conjunction with accompanying drawing:

[0016] Such as figure 1 As shown, the lentiviral vector pLenti-FlagN-shRNA of the present invention has the following structure: a U6 promoter is inserted in the middle of the lentiviral 5' and 3'LTR for transcription of a shRNA sequence, and the shRNA insertion region (ggatccgcgcggtgaccctcgag) contains BamHI and XhoI double enzymes cutting site, which can be inserted into the annealed shRNA sequence. The EF1a promoter transcribes and expresses the foreign gene fused with the Flag tag, and the Flag tag is fused at the N-terminal of the foreign gene. The multi-cloning site (GTTAACGAATTCGCTAGC) contains three restriction sites of HpaI, EcoRI and NheI for inserting the foreign gene, among which HpaI For blunt-end digestion, any gene can be inserted. IRES (Internal ribosome entry site, IRES), also known as the internal ribosome entry sequence, is used to initiate the expressi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to a novel endogenous gene expression substituting lentivirus vector. According to the present invention, a U6 promoter is inserted between the 5' LTR and the 3' LTR of lentivirus so as to perform transcription of a segment of a shRNA sequence, and the shRNA insertion region contains double restriction enzyme cutting sites such as BamHI and XhoI so as to insert the shRNA sequence after annealing; an EFla promoter is used for transcriptional expression of a Flag tag fused exogenous gene, the Flag tag is fused on the N terminal of the exogenous gene, and the multiple cloning site contains three restriction enzyme cutting sites such as HpaI, EcoRI and NheI3 so as to insert the exogenous gene, wherein the HpaI is the blunt-ended restriction enzyme cutting site so as to ensure insertion of any genes; IRES is used for starting the EGFP reporter gene; and the production of two proteins through the one RNA transcripted from the EFla can be achieved. In addition, the disadvantages of the conventional vectors are overcome, and the fast and efficient intracellular genetically modified way is provided.

Description

technical field [0001] The invention relates to a lentiviral vector, in particular to a novel lentiviral vector for replacing endogenous gene expression and a construction method thereof. Background technique [0002] Lentiviral vector is transformed from human immunodeficiency virus (Human immunodeficiency virus, HIV), which eliminates the pathogenicity of HIV to the greatest extent, and cannot replicate itself, with artificially synthesized foreign genes and artificially improved viruses coat. The advantages of lentiviral vectors are 1) they can infect a variety of cell lines, including dividing and non-dividing cells; 2) they have minimal toxicity and immune response; 3) they are efficiently integrated into the host genome to form a stable exogenous Gene expression, ideal for establishing stable transgenic mouse and human ES cell lines. [0003] The main method of routine gene research is to introduce exogenous genes into cells to make them overexpressed, or to make the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/867C12N15/66
Inventor 陈齐刘军谢丹
Owner HANGZHOU NIUBEI BIOTECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More