Molecular ID and identification method of cordyceps sinensis

A molecular ID card, Cordyceps sinensis technology, applied in the field of identification of Chinese medicinal materials source varieties, can solve the problems of high subjectivity, poor versatility, and high requirements for observer experience, and achieve the effect of wide applicability and accurate identification

Inactive Publication Date: 2015-08-12
INST OF MEDICINAL PLANT DEV CHINESE ACADEMY OF MEDICAL SCI
View PDF1 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The existing traditional identification methods for Cordyceps sinensis are extremely difficult to accurately identify in practical applications, and there are defects such as high subjectivity, poor versatility, and high requirements for observer experience
Molecular identification methods are relatively accurate and reliable, but they all require sequencing or a large number of PCR and electrophoresis and later data processing, which is not conducive to the establishment of large-scale standardization

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular ID and identification method of cordyceps sinensis
  • Molecular ID and identification method of cordyceps sinensis
  • Molecular ID and identification method of cordyceps sinensis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] 1) 53 samples of Cordyceps sinensis O.sinensis and its obfuscated products C.gunnii, Cicadae, C.militaris, O.nutans, and O.robertsii were collected from different origins, respectively. A 20 mg sample was ground on a MM400 ball mill (Retsch, Germany), and the total DNA was extracted with a plant genomic DNA kit from Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0033] 2) PCR amplification

[0034] The primer sequence is ITSF 5'-GGAAGTAAAAGTCGTAACAAGG-3'; ITSR 5'-TCCTCCGCTTATTGATATGC-3', synthesized by Sangon Bioengineering Co., Ltd. (Beijing). Primers were dissolved in sterile deionized and diluted to 2 μmol / μL. 25μL reaction system: LATaq PCR buffer II (Mg 2+ Plus) (10×) 2.5μL, dNTPs mixture 1μL (2.5mmol / L), each primer 0.6μL (10μmol / L), template DNA 1μL (- about 30ng), LA Taq DNA polymerase 1.0U, plus sterilized double-distilled Water to 25 μL for PCR amplification.

[0035] PCR reaction program: Perform the amplification reaction on the PCR instrument acco...

Embodiment 2

[0044] The identification of embodiment 2 Cordyceps sinensis mycelium

[0045] Using the same method as in Example 1, the difference is that the Cordyceps sinensis mycelium is used as a sample, DNA is extracted, and identification is carried out. As a result, the above two SNP sites can also be specifically detected. And the sequence comparison found that the ITS sequence of DNA of Cordyceps sinensis decoction pieces contained AGCAGTTGCCTCGGCGGGACCGC and ACCCCGCCGCGGCTCCCCTGCGCAGT.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a molecular ID of cordyceps sinensis, wherein the molecular ID includes a nucleotide sequence represented as the SEQ ID No.1 and / or the SEQ ID No.2. By means of the molecular ID and an identification method, the cordyceps sinensis can be separated from fake products being similar with the cordyceps sinensis in appearance. The method is wider in applicability and can be used for detecting any samples of which DNA can be extracted, so that quick and accurate identification of raw material drugs and mycelium of the cordyceps sinensis can be achieved.

Description

technical field [0001] The invention belongs to the technical field of identification of source varieties of Chinese medicinal materials, and in particular relates to a molecular ID card of Cordyceps sinensis and an identification method. Background technique [0002] Cordyceps sinensis (Ophiocordyceps Sinensis) is a dry complex of the subunits and larval corpses of the ergot fungus Cordyceps sinensis parasitizing on the larvae of the bat moth family insects. It is a rare and valuable Chinese herbal medicine in my country. Due to the special habitat of Cordyceps sinensis itself, its slow growth, limited natural output, coupled with the destruction of the ecological environment and long-term over-excavation, its natural resources are gradually exhausted. At present, the price of Cordyceps sinensis is more expensive than gold, and its counterfeit products often appear in the market. Such as: Cordyceps C.gunnii, Cicadae, C.militaris, Cordyceps O.nutans, Cordyceps O.robertsii,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6895C12Q1/6869
Inventor韩建萍向丽廖保生陈士林
OwnerINST OF MEDICINAL PLANT DEV CHINESE ACADEMY OF MEDICAL SCI