Unlock instant, AI-driven research and patent intelligence for your innovation.

New Rice Hybrid Disadvantage Gene and Its Application

A hybrid disadvantage and gene technology, applied in the field of biotechnology and breeding, can solve the problems of abnormal growth and development, hindering gene communication between parents, and hindering the full exploration and comprehensive utilization of heterosis.

Active Publication Date: 2018-08-14
CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Heterosis is a form of reproductive isolation, manifested as F1 plants formed by artificial construction or natural hybridization between different species, or between different subpopulations of the same species, with abnormal growth and development, usually unable to survive to the reproductive growth stage, thus hindering gene exchange between parents
And this kind of genetic exchange between different parents is the prerequisite for the use of heterosis, so the existence of heterosis hinders breeders from fully exploring and fully utilizing heterosis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • New Rice Hybrid Disadvantage Gene and Its Application
  • New Rice Hybrid Disadvantage Gene and Its Application
  • New Rice Hybrid Disadvantage Gene and Its Application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0129] Example 1 Discovery and positional cloning of AD1 and AD2

[0130] From the CSSLs (chromosomal segment replacement lines) constructed from Teqing as the recurrent parent and Hainan common wild rice as the donor parent, a line 05-SW52 was found to exhibit a heterosis phenotype. Construction of BC with this CSSL and Tealan hybrid 4 f 2 The population was isolated, and the dominant gene AD1 from wild rice was analyzed and initially mapped (while the gene from cultivated rice Ruteqing was recessive gene ad1). Further use the plants in the segregation population showing heterozygosity at the AD1 locus to derive a fine-mapping population, and finally map AD1 to the range of 13.2kb on the short arm of chromosome 11. At the same time, a pair of near isogenic (NIL) lines (NIL) NIL(ad1) and NIL(AD1) with the same genetic background and only difference at the AD1 locus were constructed by backcrossing.

[0131] Among them, NIL(AD1) showed symptoms of heterosis, while the growth...

Embodiment 2

[0134] Example 2 Construction of AD1 vector

[0135] Using the Hainan common wild rice BAC library newly constructed by the inventor, a BAC clone containing the AD1 locus was screened. Through the full sequencing of the BAC clone, the sequence analysis of the AD1 locus of Hainan wild rice found that compared with Teqing, there is a large fragment insertion of about 30kb in Hainan wild rice. This fragment contains two functional coding genes, 25L1 and 25L2.

[0136] Use BAC clones to construct a subclone library: perform Sau3AI partial digestion on BAC clones, pick 20kb ~ 40kb fragments and connect them to the binary vector pYLTAC747-SacB digested with BamHI in advance, and use electroporation (2.0kV, 200Ω, 252F) method The linker was transformed into Escherichia coli competent DH10B. Design 25L1, 25L2 specific primers:

[0137] 25L1-F: GGCGTCTTGAACTGGTAG; (SEQ ID NO.: 7)

[0138]25L1-R: GCTGTGGTGTAGGTATGC; (SEQ ID NO.:8)

[0139] 25L2-F: CCAGAGGCAATCCTGAACAT; (SEQ ID NO.:...

Embodiment 3

[0142] Example 3 Construction and Verification of AD2 Vector

[0143] During the construction of the AD2 complementary vector, because the target fragment is relatively long, the Teqing BAC clone containing the AD2 gene was used as a template, and the high-fidelity amplification enzyme KOD was used to amplify the target gene fragment 290C1 (2646 positions upstream of the gene) in segments with the following primers to position 4780 within the gene) and 290C2 (position 4346 within the gene to position 1485 downstream of the transcription end site).

[0144] 290C1-F: ACATGCATGCTCCTTCCGTTGTTAATTGTTAC (SEQ ID NO.: 11)

[0145] 290C1-R: GGACGCTGACTCCATCTACC (SEQ ID NO.: 12)

[0146] 290C2-F: GAACTACCAACCACCCAATAAAC (SEQ ID NO.: 13)

[0147] 290C2-R: GGGGCCAAACATGGCGACGATACGAT (SEQ ID NO.: 14)

[0148] Fragments 290C1 and 290C2 were digested with SphI and StuI and StuI and EcoRI, respectively. Simultaneously, the binary expression vector pCAMBIA1301 was digested with SphI and Ec...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides a new rice hybrid inferior gene and applications thereof. Specifically the present invention provides new genes (25L1, 25L2) derived from rice and a new mutation gene (AD2). According to the present invention, when a maternal plant to be cultivated concurrently has the three genes, the cultivated filial rice can produce hybrid inferior phenomenon, and the phenomenon is regulated by the temperature, such that any one, two or three genes selected from the three genes can be detected so as to predict whether the hybrid inferior phenomenon can be produced, or the transgene or molecular biology method is utilized to reduce the expression level and / or the activity of the one, two or three genes of the three genes or the proteins thereof so as to avoid the hybrid inferior production of the hybrid rice, such that the broad application prospects are provided.

Description

technical field [0001] The invention belongs to the field of biotechnology and breeding, in particular, the invention relates to a gene causing rice hybrid disadvantage and its application. Background technique [0002] Rice (Oryza sativa) is the most important food crop, and more than one-third of the world's population depends on rice as a staple food. Because rice has the advantages of small genome, fine genetic and physical maps, relatively easy transgenic technology, and collinearity with other grass crops, rice has always been an excellent model plant. With the completion of rice genome sequencing, human beings have entered the post-genome era, and the comprehensive research on rice functional genome and gene annotation has become the frontier field of life science. Therefore, the study of rice functional genes is of great significance to socioeconomic development and biological research. [0003] In order to solve the contradiction between population growth and the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/82C12N5/10C12N9/56C12N15/57A01H5/00A01H6/46
Inventor 林鸿宣陈沈陈豪高继平单军祥施敏
Owner CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI