Rice blast resistance gene pi50 and its preparation method and application

A technology of resistance gene and rice blast, which is applied in the fields of botanical equipment and methods, biochemical equipment and methods, and application, etc., can solve problems such as short-lived resistance, and achieve the effect of shortening breeding time.

Active Publication Date: 2017-04-19
PLANT PROTECTION RES INST OF GUANGDONG ACADEMY OF AGRI SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

From the perspective of sustainable agricultural development, breeding and utilizing disease-resistant varieties is the most effective, safest and environmentally friendly method to control rice blast. However, the diversity and variability of the rice blast fungus population and the lack of resistance genes Full understanding and effective use lead to short-lived resistance of single resistant varieties (usually only 2-4 years), and become the most difficult problem for breeders (Zheng Zhao et al. 2009)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rice blast resistance gene pi50 and its preparation method and application
  • Rice blast resistance gene pi50 and its preparation method and application
  • Rice blast resistance gene pi50 and its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1 Analysis and Determination of Rice Blast Resistance Gene Pi50

[0028] 1. Annotation and sequence analysis of rice blast resistance gene Pi50 candidate gene

[0029] In order to determine the candidate gene of Pi50, the inventors of the present invention used the reference sequence of Nipponbare, through two kinds of gene prediction software RiceGAAS (http: / / ricegaas.dna.affrc.go.jp) and Softberry's FGENESH (http: / / www. softberry.com) performed gene prediction and annotation analysis on the target gene region. In Nipponbare, the candidate resistance genes in the Pi50 region are candidate genes of seven nucleotide binding sites and leucine-rich repeat (NBS-LRR) (Pi501-NP, Pi502- NP, Pi503-NP, Pi504-NP, Pi505-NP, Pi506-NP and Pi507-NP), among which Pi501-NP and Pi507-NP are highly conserved among the varieties held by the reported Pi2 / 9 family, with little difference. Based on the completeness of genes and the presence / absence (presence / absence, P / A) of specif...

Embodiment 2

[0039] Example 2: Genetic complementation experiment of rice blast resistance gene Pi50 and identification of transformants

[0040] 1. Obtaining the Pi50-N4 gene

[0041] Using the EBZ genome as a template, the Pi50-N4 genome gene was amplified by the following primers:

[0042] Upstream primer F2: 5'- ACGAATTCGAGCTCGGTACC CTTGACATCCAAACCGCACC-3';

[0043] Downstream primer R2: 5'- AGTGCCAAGCTTCGGCGCGCC TCAGCCAGCTTGAGCTGTGC-3'.

[0044] The PCR reaction system is: high-fidelity enzyme KOD plus neo 0.4μl, EBZ genome template 1.2μl (100pg~50ng), DMSO 0.5μl, primer F2 (10μM) 0.6μl, primer R2 (10μM) 0.6μl, dNTP (2mM) 4μl , 10 μl of 2-fold concentration buffer solution (2×buffer), and 20 μl of double distilled water.

[0045] The PCR temperature cycle conditions are: 94°C for 2 minutes; 98°C for 10 seconds, 56°C for 30 seconds, 68°C for 9 minutes, and the extension time at 68°C runs 5 cycles with a gradient of 10 seconds in each cycle; 98°C for 10 seconds, 68°C for 10 min...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a rice blast resistance gene Pi50 as well as its preparation method and application. The nucleotide sequence of the rice blast resistance gene Pi50 is shown in SEQ ID NO.1. The rice blast resistance gene Pi50 can be obtained by chemical synthesis; or the rice blast resistance gene Pi50 can be obtained by PCR amplification using EBZ genome DNA as a template by designing primers. The rice blast resistance gene Pi50 has excellent disease resistance and can be used for breeding rice resistant to rice blast.

Description

technical field [0001] The invention relates to a rice blast resistance gene, in particular to a rice blast resistance gene Pi50 and its preparation method and application. Background technique [0002] Rice is one of the most important food crops. More than half of the world's population uses rice as a staple food. The rice blast caused by Magnapothe oryzae has caused serious harm to the safe production of rice, causing serious food losses every year. loss. From the perspective of sustainable agricultural development, breeding and utilizing disease-resistant varieties is the most effective, safest and environmentally friendly method to control rice blast. However, the diversity and variability of the rice blast fungus population and the lack of resistance genes Full understanding and effective utilization lead to short-lived resistance of single resistant varieties (usually only 2-4 years), and become the most difficult problem for breeders (Zheng Zhao et al. 2009). There...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/29C12N15/10C07K14/415C12N15/82A01H5/00
CPCC12N15/8261C07K14/415C12N15/10C12N15/82Y02A40/146
Inventor苏菁朱小源陈深汪文娟汪聪颖曾列先杨健源
OwnerPLANT PROTECTION RES INST OF GUANGDONG ACADEMY OF AGRI SCI