A kind of ginger floral benzene cyclic ester floral fragrance gene hcbsmt and its application
A benzene ring type and genetic technology, applied in the field of genetic engineering, to achieve the effect of shortening the breeding time
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Example 1 HCBSMT Acquisition of gene cDNA and full-length DNA
[0032] S1. Extraction of RNA from ginger flower petals: Trizol method was used to extract RNA from ginger flower petals. Weigh 0.1 g of the petal material and quickly grind it into powder in liquid nitrogen, transfer it to a centrifuge tube containing 1.0 ml Trizol, shake vigorously to mix, and let it stand at room temperature for 5 min. Centrifuge at 12,000 g for 5 min at 4°C. Carefully aspirate the supernatant, transfer it to a new centrifuge tube, add 200 μl of chloroform, cover the centrifuge tube tightly, mix until the solution emulsifies and turns milky white, and let stand at room temperature for 5 min. Centrifuge at 12,000 g for 15 min at 4°C. Aspirate the supernatant and transfer it to another new centrifuge tube, add an equal volume of isopropanol, invert the centrifuge tube up and down to mix thoroughly, and let stand at room temperature for 10 min. Centrifuge at 12,000 g for 10 min at 4°C. ...
Embodiment 2
[0036] Example 2 The determination and HCBSMT Gene expression analysis of
[0037] S1. Determination of floral aroma substances of benzene cyclic esters of ginger flower: seal the sample to be tested in the gas measuring device, add 1.728 μg ethyl caprate as internal standard at the same time, collect flower aroma substances and internal standard substances for 30 min, insert 50 / 30 μmDVB / CAR / PDMS extraction head (Supelco) for 30 min, then GC-MS detection and weighing of samples. The conditions of gas chromatography (Agilent 7890A GC system) are: HP-5MS column (30 m×0.25 μm); high-purity helium carrier gas, inlet temperature of 250°C, splitless injection, and column flow rate of 1 ml / min, the analysis time is 3 min. Temperature program: the initial column temperature was 40°C, kept for 2 minutes, then raised to 250°C at a rate of 10°C / min, and kept for 5 minutes. Mass spectrometry (Agilent 5975CMSD) conditions are: interface temperature 220°C, electron bombardment source EI...
Embodiment 3
[0040] Example 3 In vitro functional analysis of HcBSMT
[0041] S1. Carrier Construction: According to HCBSMT The cDNA sequence of the gene, designed to contain Eco RI and not Specific primers for restriction site I, upstream primer F: GAATTC ATGGGTTTGAAGGTGGAGCA, as shown in SEQ ID NO: 13; downstream primer R: GCGGCCGC ATACTCTTTTCTTCAAGGCAA TGAC, as shown in SEQ ID NO:14. The high-fidelity enzyme KOD-plus was used for PCR amplification. After the amplified product was recovered, it was digested with the pET-30a vector at 37°C for 3 h at the same time. After the digestion, the DNA fragment was purified. The purified target fragment and vector were ligated overnight at 16°C with T4 DNA ligase, and the ligated product was transformed into E. coli After the DH5α competence was confirmed by sequencing, the recombinant plasmid was transferred into the Rosetta2 (DE3) pLysS strain.
[0042] S2. Recombinant protein expression and purification: Pick a single colony and ino...
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com