Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Kit for auxiliary evaluation of lung cancer genetic risks of to-be-tested person

A kit and risk technology are applied in the field of kits to assist in evaluating the genetic risk of lung cancer in a subject, which can solve the problems of poor independence of related genes, linkage disequilibrium, etc., so as to avoid cross infection, reduce morbidity, and detect methods simple effect

Inactive Publication Date: 2015-08-26
GUANGZHOU TOPGENE TECH CO LTD
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The defect of the above technical solution is that the independence of the related genes is poor and there is linkage disequilibrium

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for auxiliary evaluation of lung cancer genetic risks of to-be-tested person
  • Kit for auxiliary evaluation of lung cancer genetic risks of to-be-tested person
  • Kit for auxiliary evaluation of lung cancer genetic risks of to-be-tested person

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] This embodiment provides a kit for assisting in evaluating the genetic risk of lung cancer of a test subject. The kit includes: a PCR reaction system, a PCR product purification system, and a sequencing reaction system.

[0056] Wherein, the PCR reaction system includes the following primers:

[0057] (1) Primers for the single nucleotide polymorphism site rs2285947 (G→A) on the DNAH11 gene:

[0058] rs2285947 upstream primer: AGTATGATGAGTTTGGAGCA (SEQ ID NO: 1);

[0059] rs2285947 downstream primer: GGAAATAAGCCAAACTGAGA (SEQ ID NO: 2);

[0060] (2) Primers targeting the single nucleotide polymorphism site rs2494938 (G→A) on the LRFN2 gene.

[0061] rs2494938 upstream primer: ACTAAGCCTCAGTCAAGGTTTG (SEQ ID NO: 3);

[0062] rs2494938 downstream primer: TAGCGAGGCATTTGGAACAG (SEQ ID NO: 4);

[0063] (3) Primers for the single nucleotide polymorphism site rs4488809 (T→C) on the TP63 gene:

[0064] s4488809 upstream primer: GGGAAGGTAGAATATATGAGT (SEQ ID NO: 5);

[0065...

Embodiment 2

[0095] The difference between this example and Example 1 is that the PCR reaction system includes the following primers,

[0096] (1) Primers for the single nucleotide polymorphism site rs2285947 (G→A) on the DNAH11 gene:

[0097] rs2285947 upstream primer: AGTATGATGAGTTTGGAGCA (SEQ ID NO: 1);

[0098] rs2285947 downstream primer: GGAAATAAGCCAAACTGAGA (SEQ ID NO: 2);

[0099] (2) Primers targeting the single nucleotide polymorphism site rs2494938 (G→A) on the LRFN2 gene.

[0100] rs2494938 upstream primer: ACTAAGCCTCAGTCAAGGTTTG (SEQ ID NO: 3);

[0101] rs2494938 downstream primer: TAGCGAGGCATTTGGAACAG (SEQ ID NO: 4);

[0102] (3) Primers for the single nucleotide polymorphism site rs4488809 (T→C) on the TP63 gene:

[0103] s4488809 upstream primer: GGGAAGGTAGAATATATGAGT (SEQ ID NO: 5);

[0104] rs4488809 downstream primer: AAGCCCTCTCAATATCTG (SEQ ID NO: 6);

[0105] (4) Primers for the single nucleotide polymorphism site rs9387478 (C→A) on the DCBLD1 gene:

[0106] rs9...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a kit for auxiliary evaluation of lung cancer genetic risks of a to-be-tested person. The kit comprises a primer specific to single nucleotide polymorphic sites rs2285947 (G->A) on DNAH 11 genes and a primer specific to single nucleotide polymorphic sites rs2494938 (G->A) on LRFN2 genes. According to the kit for auxiliary evaluation of lung cancer genetic risks of the to-be-tested person, the selected single nucleotide polymorphic sites are significantly related among Asian people and mutually independent, linkage disequilibrium is absent, and thereby, representativeness, independence and value-at-risk hereditability are achieved in terms of the site selection. Meanwhile, the invention provides an assessment method of detected results of the kit.

Description

technical field [0001] The invention relates to a kit for assisting in evaluating the genetic risk of lung cancer of a test subject. Background technique [0002] Lung cancer is one of the malignant tumors with the fastest increasing morbidity and mortality and the greatest threat to the health and life of the population. In the past 50 years, many countries have reported that the morbidity and mortality of lung cancer have increased significantly. The incidence and mortality of lung cancer in men rank first among all malignant tumors, and the incidence and mortality of lung cancer occupy the second place in women. [0003] Gene sequencing is a new type of genetic testing technology, which can analyze and determine the full sequence of genes from blood or saliva, and predict the possibility of suffering from various diseases, so as to achieve early prevention and treatment. [0004] Chinese patent application 201210021993.1 provides a non-invasive detection kit for detectin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
Inventor 由晓斌兰兆吉
Owner GUANGZHOU TOPGENE TECH CO LTD
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com