Novel enhancer and application thereof
A technology of promoters and subsequences, applied in the direction of using vectors to introduce foreign genetic material, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problem that the expression level of recombinant proteins is difficult to meet the requirements of industrial production and has no directionality.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Embodiment 1 Synthesis of the enhancer of the present invention
[0039] The enhancer was synthesized by PCR, and NruI (TCGCGA) restriction sites were added to the 5' and 3' ends to facilitate insertion into the 5' end of the expression vector promoter (no directionality).
[0040] Enhancer 1:
[0041] CATTGCATACGTTGTATCCATATCATAATATGTACATTTATATTGGCTCATGTCCAACATTACCGCCATGTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCTAGGGACTTTCCAATGGGTTTTGCCCAGTACATAAGGTCAATAGGGGTGACGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACTTCCCATAGTAACCCCGCCCATTGACGTCAATAATGACGTATGCGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCGGTGTGGAAAGCCCATTGACGTCAATGGGA(SEQ ID NO:1)
[0042] Enhancer 2:
[0043] TGGGTTTTGCCCAGTACATAAGGTCAATAGGGGTGACGCGTTACATAACTTACGGTAAATGGCCCGTACTGAGTCATTAGGGACTTTCCAATGGGTTTTGCCCAGTACATAAGGTCAATAGGGGTGAATCAACAGGAAAGTCCCATTGGAGCCAAGTACACTGAGTCAATAGGGACTTTC...
Embodiment 2
[0050] The amplification of embodiment 2hCMV enhancer
[0051] Using the plasmid pIRESneo3 (purchased from Clontech) as a template and the hCMV enhancer sequence as a reference, design primers (with NruI (TCGCGA) restriction sites added at the 5′ and 3′ ends) for polymerase chain reaction to amplify hCMV enhancer The subsequences and reaction conditions are shown in Table 1.
[0052] The resulting PCR product was ligated with SmaI-treated pUC57 (purchased from Fermentas), and sequenced to obtain the correct target sequence.
[0053] Table 1 PCR reaction conditions
[0054]
Embodiment 3
[0055] Embodiment 3 Amplification of the human EF-1α promoter
[0056] Using the plasmid pEF6 / V5-HisA (purchased from Invitrogen) as a template and the human EF-1α promoter sequence as a reference, primers were designed and polymerase chain reaction was performed to amplify the human EF-1α promoter sequence. The reaction conditions were as follows: Table 1.
[0057] The resulting PCR product was ligated with SmaI-treated pUC57 (purchased from Fermentas), and sequenced to obtain the correct target sequence.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap