Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Novel enhancer and application thereof

A technology of promoters and subsequences, applied in the direction of using vectors to introduce foreign genetic material, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problem that the expression level of recombinant proteins is difficult to meet the requirements of industrial production and has no directionality.

Active Publication Date: 2015-10-14
SUNSHINE GUOJIAN PHARMA (SHANGHAI) CO LTD
View PDF5 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] ②No directionality
[0008] ④ No species and gene specificity
However, the expression level of most recombinant proteins is difficult to meet the requirements of industrial production. Improving the expression level of recombinant proteins through transformation of expression vectors and host transformation has become a key task for the expression of recombinant proteins, especially recombinant antibody proteins.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel enhancer and application thereof
  • Novel enhancer and application thereof
  • Novel enhancer and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Embodiment 1 Synthesis of the enhancer of the present invention

[0039] The enhancer was synthesized by PCR, and NruI (TCGCGA) restriction sites were added to the 5' and 3' ends to facilitate insertion into the 5' end of the expression vector promoter (no directionality).

[0040] Enhancer 1:

[0041] CATTGCATACGTTGTATCCATATCATAATATGTACATTTATATTGGCTCATGTCCAACATTACCGCCATGTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCTAGGGACTTTCCAATGGGTTTTGCCCAGTACATAAGGTCAATAGGGGTGACGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACTTCCCATAGTAACCCCGCCCATTGACGTCAATAATGACGTATGCGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCGGTGTGGAAAGCCCATTGACGTCAATGGGA(SEQ ID NO:1)

[0042] Enhancer 2:

[0043] TGGGTTTTGCCCAGTACATAAGGTCAATAGGGGTGACGCGTTACATAACTTACGGTAAATGGCCCGTACTGAGTCATTAGGGACTTTCCAATGGGTTTTGCCCAGTACATAAGGTCAATAGGGGTGAATCAACAGGAAAGTCCCATTGGAGCCAAGTACACTGAGTCAATAGGGACTTTC...

Embodiment 2

[0050] The amplification of embodiment 2hCMV enhancer

[0051] Using the plasmid pIRESneo3 (purchased from Clontech) as a template and the hCMV enhancer sequence as a reference, design primers (with NruI (TCGCGA) restriction sites added at the 5′ and 3′ ends) for polymerase chain reaction to amplify hCMV enhancer The subsequences and reaction conditions are shown in Table 1.

[0052] The resulting PCR product was ligated with SmaI-treated pUC57 (purchased from Fermentas), and sequenced to obtain the correct target sequence.

[0053] Table 1 PCR reaction conditions

[0054]

Embodiment 3

[0055] Embodiment 3 Amplification of the human EF-1α promoter

[0056] Using the plasmid pEF6 / V5-HisA (purchased from Invitrogen) as a template and the human EF-1α promoter sequence as a reference, primers were designed and polymerase chain reaction was performed to amplify the human EF-1α promoter sequence. The reaction conditions were as follows: Table 1.

[0057] The resulting PCR product was ligated with SmaI-treated pUC57 (purchased from Fermentas), and sequenced to obtain the correct target sequence.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an artificially synthesized DNA enhancer and application thereof. The enhancer can be added to a recombinant protein expression vector of a mammalian cell and used for enhancing the intensity of transcriptional activity of a promoter, so that the secretory expression of proteins from mammals and other sources can be enhanced and the expression quantity of foreign proteins in animal cells can be improved greatly.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to an enhancer for enhancing the transcriptional activity of a promoter and promoting the secretion and expression of a mammalian protein in mammalian cells and an application thereof. technical background [0002] High-efficiency expression of foreign genes in host cells is a prerequisite for protein structure and function analysis, protein or polypeptide drug research and development. Mammalian cells express foreign proteins such as antibodies. Initially, antibody genes are reintroduced into lymphocytes and guided by viruses (such as SV40) or IgG promoter enhancers. The antibodies produced have corresponding binding abilities and effector functions, but the expression Volume is very low. Commonly used non-lymphoid cells include Chinese hamster ovary (CHO) cells, baby hamster kidney (BHK) cells, COS cells, mouse NSO thymoma cells and mouse myeloma SP2 / 0 cells. Recombinant proteins ex...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/85C12N5/10C12N15/67
Inventor 张玉晶张成海周远锋
Owner SUNSHINE GUOJIAN PHARMA (SHANGHAI) CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com