Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of long-chain non-coding RNA (ribonucleic acid) gene LOC553103 in preparation of nasopharynx cancer prognosis preparation

A long-chain non-coding, nasopharyngeal cancer technology, used in DNA/RNA fragments, recombinant DNA technology, determination/inspection of microorganisms, etc.

Active Publication Date: 2015-12-30
CENT SOUTH UNIV
View PDF3 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Previously, there was no literature report on the function of LOC553103

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of long-chain non-coding RNA (ribonucleic acid) gene LOC553103 in preparation of nasopharynx cancer prognosis preparation
  • Application of long-chain non-coding RNA (ribonucleic acid) gene LOC553103 in preparation of nasopharynx cancer prognosis preparation
  • Application of long-chain non-coding RNA (ribonucleic acid) gene LOC553103 in preparation of nasopharynx cancer prognosis preparation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0088] Example 1, real-time fluorescent quantitative PCR method detection confirmed that BART6-3p was up-regulated in nasopharyngeal carcinoma

[0089] 1. Materials and methods:

[0090] Collect 5 cases of normal nasopharyngeal epithelial tissues and 18 cases of nasopharyngeal carcinoma tissues, extract total RNA with Trizol (product of Invitrogen Company), reverse transcribe 2 μg RNA into cDNA with miScript reverse transcription kit (product of Qiagen Company), and use QuantiTectSYBRGreenPCR kit (Qiagen company product) Real-time fluorescent quantitative PCR was used to detect the expression of BART6-3p and internal reference gene RNU6B. The public primers (UniversalPrimer) of microRNA and the specific primers of BART6-3p and RNU6B were all designed and synthesized by Qiagen.

[0091] Real-time fluorescence quantitative PCR reaction system

[0092]

[0093] Real-time fluorescent quantitative PCR reaction steps

[0094] 194℃5min

[0095] 295℃10sec

[0096] 358℃30sec

...

Embodiment 2

[0106] Example 2, in situ hybridization detection found that the expression of BART6-3p in nasopharyngeal carcinoma and gastric carcinoma is related to the prognosis of patients

[0107] 1. Material method

[0108] 1.1 Design and synthesis of hybridization probes

[0109] In order to detect the expression of BART6-3p by in situ hybridization, we designed an oligonucleotide probe for detecting the expression of BART6-3p by in situ hybridization and a positive control in situ hybridization oligonucleotide probe.

[0110] BART6-3p probe: UCUAAGGCUAGUCCGAUCCCCG

[0111] Positive control probe (to detect the housekeeping gene GAPDH):

[0112] GAPDH probe: CAGUAGAGGCAGGGAUGAUGUUCU

[0113] The gene-specific oligonucleotide probe sequences designed above were synthesized by chemical synthesis method, and uracil in the probe sequences was labeled with biotin (bio-U) during the synthesis process.

[0114] 1.2 Oligonucleotide probe labeling kit and in situ hybridization detection re...

Embodiment 3

[0180] Example 3, Overexpression of BART6-3p inhibits growth, proliferation, invasion and metastasis of tumor cells

[0181] 1. Material method

[0182] 1.1 Cell culture and transfection

[0183] EBV-negative nasopharyngeal carcinoma cell lines 5-8F, HNE2, and gastric cancer cell AGS were purchased from the Cell Center of Central South University. The RPMI1640 medium and fetal bovine serum used for cell culture, and the trypsin used for digesting cells were all products of Gibco, USA.

[0184] BART6-3p is synthesized by Invitrogen Company through chemical synthesis, and the sequence is:

[0185] CGGGGAUCGGACUAGCCUUAGA

[0186] Tumor cell lines with good growth status were divided into 2×10 5 Cells / well were seeded in a 6-well plate, and the 6-well plate was placed at 37°C, 5% CO 2 In the incubator, the transfection of BART6-3p can be started when the cells to be cultured grow to a density of 50-70%; the transfection process is as follows:

[0187] Add 8 μl of Hiperfect tr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of a long-chain non-coding RNA (ribonucleic acid) gene LOC553103 in preparation of a nasopharynx cancer prognosis preparation. The gene LOC553103 is used for preparing a preparation for monitoring recurrence, metastasis and prognostic prediction of nasopharynx cancer; the expression level of the gene LOC553103 in nasopharynx cancer tissue has a positive correlation with recurrence and metastasis of nasopharynx cancer; a serial number of the gene in NCBI (National Center of Biotechnology Information) is NR-110997. The survival time of a patient with high expression of LOC553103 is shorter, and accordingly, LOC553103 can be taken as a prediction molecular marker for recurrence and metastasis of nasopharynx cancer. According to the application, a powerful tool for molecular biology is provided for auxiliary diagnosis and prognostic prediction of nasopharynx cancer, and the gene LOC553103 has profound clinical significance and great popularization and application prospects.

Description

technical field [0001] The invention belongs to the field of tumor molecular biology, and in particular relates to a method for preparing preparations for monitoring recurrence and metastasis of nasopharyngeal carcinoma and predicting prognosis by using long-chain non-coding RNA gene LOC553103. Background technique [0002] Epstein-Barrvirus (EBV) is a ubiquitous human herpes virus that can infect about 95% of the adult population in the world. Except for a small number of people who occasionally cause infectious mononucleosis, most of the infected people There will not be any clinical symptoms, and EBV can remain latent in the host for a long time in most cases. However, latently infected EBV can lead to malignant tumors in some cases, including B-cell-derived Burkitt and Hodgkin's lymphoma, and epithelial-derived nasopharyngeal and gastric carcinomas. The mechanism of EBV leading to malignant tumors is not yet fully understood. It may be related to the expression of a ser...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6886C12Q2600/118C12Q2600/158C12Q2600/178
Inventor 曾朝阳李桂源熊炜李小玲李夏雨张文玲石磊龚朝建何宝玉孛昊唐艳艳杨丽婷
Owner CENT SOUTH UNIV