Immunity-enhanced type virus-like particle for presenting recombinant cat sensitinogen rFel d 1 protein, expression vector of immunity-enhanced type virus-like particle and preparation and application of mmunity-enhanced type virus-like particle
A technology of immune enhancement and allergens, applied in the field of genetic engineering, to achieve the effect of improving detection sensitivity and improving immunogenicity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0088] The embodiment of the present invention provides a method for constructing immune-enhanced virus-like particles displaying recombinant cat allergen rFeld1 protein, comprising the following steps:
[0089] 1. Expression and production of immune-enhanced virus-like particles pET28a(+)-HBcAg-rFeld1 recombinant expression vector displaying recombinant cat allergen rFeld1 protein
[0090] (1) Cloning of rFeld1 fusion protein gene
[0091] The gene is fully synthesized according to the sequence of SEQ ID NO:7.
[0092] Specifically, the sequence of said SEQIDNO:7 is:
[0093]ATGGACATTGACCCGTATAAAGAATTTGGAGCTTCTGTGGAGTTACTCTTCTTTTTTGCCTTCTGACTTCTTTCCTTCTATTCGAGATCTCTCGACACCGCCTCTGCTCTGTATCGGGAGGCCTTAGAGTCTCCGGAACATTGTTCACCTCACCACCATACAGCACTCAGGCAAGCTATTCTGTGTTGGGGTGAGTTGATGAATCTGGCCACCTGGGTCGGAGTA GGTGGTGGTGGTTCTGGTG GTGGTGGT GAAATCTGCCCGGCTGTTAAACGTGACGTTGACCTGTTCCTGACCGGTACCCCGGACGAATACGTTGAACAGGTTGCTCAGTACAAAGCTCTGCCGGTTGTTCTGGAAAACGCTCGTATCCTGAAAAACTGCGTTGACGCTAAAATGA...
Embodiment 2
[0121] This embodiment provides a preparation method of a vaccine that enhances the immunogenicity of the recombinant cat allergen rFeld1 protein, comprising the following steps:
[0122] (1) Animal immunity
[0123] The immunoenhanced virus-like particles (HBcAg-rFeld1) and the rFeld1 protein purified in Example 1 and displayed the recombinant cat allergen rFeld1 protein were respectively injected intramuscularly or subcutaneously or intraperitoneally inoculated into purebred tiger cats, each treatment group For 10 tiger cats, the amount of inoculation protein is 1 mg virus-like particles / cat, 1 mgrFeld1 protein / cat, the volume is 1 ml, and the inoculation cycle is as follows: image 3 -A shows, specifically:
[0124]The first immunization: on day 0, immunize with rFeld1 protein or HBcAg-rFeld1 protein mixed with Freund's complete adjuvant at a ratio of 1:1 (1 mg protein / 1 ml adjuvant), and set a blank control group without immunization. The day of immunization was recorded...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap