Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Immunity-enhanced type virus-like particle for presenting recombinant cat sensitinogen rFel d 1 protein, expression vector of immunity-enhanced type virus-like particle and preparation and application of mmunity-enhanced type virus-like particle

A technology of immune enhancement and allergens, applied in the field of genetic engineering, to achieve the effect of improving detection sensitivity and improving immunogenicity

Inactive Publication Date: 2016-01-06
HAINAN UNIVERSITY
View PDF7 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no report of a successful case of displaying the recombinant cat allergen rFeld1 protein on the surface of the hepatitis B virus core particle and immunizing cats with the resulting fusion protein to increase the level of Feld1-specific IgG in cats

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Immunity-enhanced type virus-like particle for presenting recombinant cat sensitinogen rFel d 1 protein, expression vector of immunity-enhanced type virus-like particle and preparation and application of mmunity-enhanced type virus-like particle
  • Immunity-enhanced type virus-like particle for presenting recombinant cat sensitinogen rFel d 1 protein, expression vector of immunity-enhanced type virus-like particle and preparation and application of mmunity-enhanced type virus-like particle
  • Immunity-enhanced type virus-like particle for presenting recombinant cat sensitinogen rFel d 1 protein, expression vector of immunity-enhanced type virus-like particle and preparation and application of mmunity-enhanced type virus-like particle

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0088] The embodiment of the present invention provides a method for constructing immune-enhanced virus-like particles displaying recombinant cat allergen rFeld1 protein, comprising the following steps:

[0089] 1. Expression and production of immune-enhanced virus-like particles pET28a(+)-HBcAg-rFeld1 recombinant expression vector displaying recombinant cat allergen rFeld1 protein

[0090] (1) Cloning of rFeld1 fusion protein gene

[0091] The gene is fully synthesized according to the sequence of SEQ ID NO:7.

[0092] Specifically, the sequence of said SEQIDNO:7 is:

[0093]ATGGACATTGACCCGTATAAAGAATTTGGAGCTTCTGTGGAGTTACTCTTCTTTTTTGCCTTCTGACTTCTTTCCTTCTATTCGAGATCTCTCGACACCGCCTCTGCTCTGTATCGGGAGGCCTTAGAGTCTCCGGAACATTGTTCACCTCACCACCATACAGCACTCAGGCAAGCTATTCTGTGTTGGGGTGAGTTGATGAATCTGGCCACCTGGGTCGGAGTA GGTGGTGGTGGTTCTGGTG GTGGTGGT GAAATCTGCCCGGCTGTTAAACGTGACGTTGACCTGTTCCTGACCGGTACCCCGGACGAATACGTTGAACAGGTTGCTCAGTACAAAGCTCTGCCGGTTGTTCTGGAAAACGCTCGTATCCTGAAAAACTGCGTTGACGCTAAAATGA...

Embodiment 2

[0121] This embodiment provides a preparation method of a vaccine that enhances the immunogenicity of the recombinant cat allergen rFeld1 protein, comprising the following steps:

[0122] (1) Animal immunity

[0123] The immunoenhanced virus-like particles (HBcAg-rFeld1) and the rFeld1 protein purified in Example 1 and displayed the recombinant cat allergen rFeld1 protein were respectively injected intramuscularly or subcutaneously or intraperitoneally inoculated into purebred tiger cats, each treatment group For 10 tiger cats, the amount of inoculation protein is 1 mg virus-like particles / cat, 1 mgrFeld1 protein / cat, the volume is 1 ml, and the inoculation cycle is as follows: image 3 -A shows, specifically:

[0124]The first immunization: on day 0, immunize with rFeld1 protein or HBcAg-rFeld1 protein mixed with Freund's complete adjuvant at a ratio of 1:1 (1 mg protein / 1 ml adjuvant), and set a blank control group without immunization. The day of immunization was recorded...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an immunity-enhanced type virus-like particle for presenting recombinant cat sensitinogen rFel d 1 protein, an expression vector of the immunity-enhanced type virus-like particle and preparation and application of the immunity-enhanced type virus-like particle. The protein subunit forming the virus-like particle is fused protein of hepatitis B core antigen and polypeptides with the amino acid sequence of SEQ ID NO:1. The amino acid sequence of the fused protein is formed by inserting the sequence SEQ ID NO:1 of polypeptides between the 78th to 81st amino acid of hepatitis B core antigen and replacing the 79th to 80th amino acid of hepatitis B core antigen. By means of HBcAg-fFel d 1 fused protein, the immunogenicity of fFel d 1 can be remarkably improved, and therefore the detection sensitivity of fFel d 1 recombined and expressed in vitro in application of in-vitro diagnosis cat allergies is improved.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to an immune-enhanced virus-like particle displaying recombinant cat allergen rFeld1 protein, its expression vector, and its preparation and application. Background technique [0002] Studies have confirmed that Feld1 is the most important allergen in cats and is the culprit in inducing cat allergy. It has been recognized by scholars to use Feld1 instead of cat fur extract to diagnose cat allergy. Therefore, Feld1 is suitable as a marker of allergic reactions in cats. However, the in vitro expression of recombinant rFeld1 obtained in existing studies is not very sensitive in the in vitro diagnosis of cat allergy. [0003] Therefore, it is necessary to provide a protocol that can improve the sensitivity of in vitro diagnosis of feline allergy. [0004] Hepatitis B core antigen (HepatitisBcore, HBc) is an important structural protein of hepatitis B virus, which can be hi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N7/04C07K19/00A61K39/35A61K47/48A61P37/08
Inventor 裴业春安晓荣侯健王大勇
Owner HAINAN UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com