A breast cancer pik3ca mutation gene and its application

A technology for mutating genes and breast cancer, applied in the fields of application, genetic engineering, plant gene improvement, etc., can solve the problem that PIK3CA gene breast cancer has not been reported, and achieve good practical application value

Active Publication Date: 2018-08-31
KUNMING UNIV OF SCI & TECH
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The S553fs*7 mutation is one of the PIK3CA gene mutations, but the PIK3CA gene S553fs*7 mutation has not been reported in breast cancer

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A breast cancer pik3ca mutation gene and its application
  • A breast cancer pik3ca mutation gene and its application
  • A breast cancer pik3ca mutation gene and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Example 1: DNA Extraction in Breast Cancer and Paracancerous Tissues

[0022] 1. Experimental materials

[0023] TES buffer (wash a 50mL centrifuge tube, after high temperature and high pressure sterilization, add 0.5mL 1M Tris-HCL, 1mL 0.5M EDTA and 2.5mL 10% SDS, add ultrapure water to make up to 50mL, adjust pH=8.0 Store at room temperature), 20mg / mL proteinase K, 3M sodium acetate (pH=5.2), TE Buffer, phenol, chloroform, isoamyl alcohol, absolute ethanol, TE solution.

[0024] 2. Experimental method

[0025] 2.1 Thaw the tissue block, cut about 0.5g of tissue, put it into a 1.5mL centrifuge tube, and cut it into pieces;

[0026] 2.2 Add 0.45mL TES buffer and mix well, then add 50μL SDS (10%), 5.0μL proteinase K (20mg / mL), mix well, digest at 56°C for 4-6h, shake once every 2h, until the solution clear

[0027] 2.3 Place it at room temperature, add an equal volume of saturated phenol (500 μL), invert to mix, 12000 rpm, centrifuge for 10 min, separate the aqueous ...

Embodiment 2

[0033] Embodiment 2: DNA extraction in blood sample

[0034] 1. Experimental materials

[0035] White blood cell lysate, red blood cell lysate, proteinase K (10mg / mL), phenol, chloroform, isoamyl alcohol, absolute ethanol, TE solution.

[0036] 2. Experimental method

[0037] 2.1 Transfer 4mL fresh blood to a 15mL centrifuge tube, add erythrocyte lysate, mix upside down, centrifuge at 4000g at 4°C for 15min;

[0038] 2.2 Remove the supernatant and wash the blood repeatedly 2-3 times;

[0039] 2.3 Remove the supernatant, add 1mL of white blood cell lysate, vortex and mix, divide evenly into two 1.5mL centrifuge tubes, and store one tube at -80°C for later use;

[0040] 2.4 Add 20 μL proteinase K (10 mg / mL) to another tube, gently invert 8 times to mix, incubate overnight at 56°C (until there is no visible suspension), and invert occasionally to mix;

[0041] 2.5 Add an equal volume of saturated phenol (500 μL), invert and mix well, centrifuge at 12,000 rpm for 10 min, separat...

Embodiment 3

[0047] Example 3: PCR amplification of exon 9 of PIK3CA gene and sequencing

[0048] 1. Experimental materials

[0049] 2×Pfu Mix, DNA template extracted in Examples 1 and 2, deionized water, forward and reverse primers for amplifying exon 9 of PIK3CA gene (see Table 1 for details), PCR machine, 1% agarose gel Gel, electrophoresis apparatus.

[0050] Table 1

[0051] Primer name

sequence (5'-3')

For-SEQ ID NO:3

AGGGTTTTTCCCAGTCACG TGCTTTTTCTGTAAATCATCTGTG

Rew-SEQ ID NO:4

AAACAGAGAATCTCCATTTTAGCACTT

[0052] 2. Experimental method

[0053] 2.1 Select DNA samples with better quality in Examples 1 and 2, including 88 cases of breast cancer tissue DNA, 19 cases of breast cancer paracancerous tissue DNA, and 22 cases of normal human blood sample DNA;

[0054] 2.2 Configure the PCR reaction system in the following table:

[0055] Table 2

[0056] 2×Pfu Mix

12.5μL

For (5μM)

1μL

Rew (5μM)

1μL

DNA t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a breast cancer PIK3CA mutation gene and its application. The mutation gene has a c.1658_1659GT>C mutation site, and its nucleotide sequence is shown in SEQ ID NO: 1; PIK3CA gene mutations were detected in 88 breast cancer tissues, 19 breast cancer adjacent tissues, and 22 normal human blood samples. For the first time, it was found that the PIK3CA gene S553fs*7 mutation was as high as 44.3% in breast cancer tissues, and 44.3% in breast cancer adjacent tumors. There is no mutation in tissue and normal human blood samples; it is suggested that this mutation can be used to assist the early diagnosis of breast cancer; therefore, the present invention is of great significance for clinical prevention and treatment of the occurrence and development of breast cancer.

Description

technical field [0001] The invention belongs to the field of biological technology, and in particular relates to a PIK3CA mutation gene in breast cancer and its application in auxiliary preparation of breast cancer diagnostic reagents. Background technique [0002] Breast cancer, the nightmare of all women and families. The Global Cancer Epidemiological Statistics (GLOBOCAN) shows that about 1.3 million women suffer from breast cancer each year, and 458,000 die from breast cancer. Whether in developed or developing countries, breast cancer is currently the most common disease faced by women all over the world. Malignant tumors are also an important cause of death in women. Since the 1990s, the incidence rate of breast cancer in China has increased more than twice that of the world, and the number of new breast cancer cases and deaths in China accounted for 12.2% and 9.6% of the world's annual breast cancer incidence, respectively. At present, breast cancer is the cancer wi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/54C12N9/12C12Q1/6886
Inventor 盛苗苗罗瑛周小龙唐文如王芳赵月光李珊珊
Owner KUNMING UNIV OF SCI & TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap