A breast cancer pik3ca mutation gene and its application
A technology for mutating genes and breast cancer, applied in the fields of application, genetic engineering, plant gene improvement, etc., can solve the problem that PIK3CA gene breast cancer has not been reported, and achieve good practical application value
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] Example 1: DNA Extraction in Breast Cancer and Paracancerous Tissues
[0022] 1. Experimental materials
[0023] TES buffer (wash a 50mL centrifuge tube, after high temperature and high pressure sterilization, add 0.5mL 1M Tris-HCL, 1mL 0.5M EDTA and 2.5mL 10% SDS, add ultrapure water to make up to 50mL, adjust pH=8.0 Store at room temperature), 20mg / mL proteinase K, 3M sodium acetate (pH=5.2), TE Buffer, phenol, chloroform, isoamyl alcohol, absolute ethanol, TE solution.
[0024] 2. Experimental method
[0025] 2.1 Thaw the tissue block, cut about 0.5g of tissue, put it into a 1.5mL centrifuge tube, and cut it into pieces;
[0026] 2.2 Add 0.45mL TES buffer and mix well, then add 50μL SDS (10%), 5.0μL proteinase K (20mg / mL), mix well, digest at 56°C for 4-6h, shake once every 2h, until the solution clear
[0027] 2.3 Place it at room temperature, add an equal volume of saturated phenol (500 μL), invert to mix, 12000 rpm, centrifuge for 10 min, separate the aqueous ...
Embodiment 2
[0033] Embodiment 2: DNA extraction in blood sample
[0034] 1. Experimental materials
[0035] White blood cell lysate, red blood cell lysate, proteinase K (10mg / mL), phenol, chloroform, isoamyl alcohol, absolute ethanol, TE solution.
[0036] 2. Experimental method
[0037] 2.1 Transfer 4mL fresh blood to a 15mL centrifuge tube, add erythrocyte lysate, mix upside down, centrifuge at 4000g at 4°C for 15min;
[0038] 2.2 Remove the supernatant and wash the blood repeatedly 2-3 times;
[0039] 2.3 Remove the supernatant, add 1mL of white blood cell lysate, vortex and mix, divide evenly into two 1.5mL centrifuge tubes, and store one tube at -80°C for later use;
[0040] 2.4 Add 20 μL proteinase K (10 mg / mL) to another tube, gently invert 8 times to mix, incubate overnight at 56°C (until there is no visible suspension), and invert occasionally to mix;
[0041] 2.5 Add an equal volume of saturated phenol (500 μL), invert and mix well, centrifuge at 12,000 rpm for 10 min, separat...
Embodiment 3
[0047] Example 3: PCR amplification of exon 9 of PIK3CA gene and sequencing
[0048] 1. Experimental materials
[0049] 2×Pfu Mix, DNA template extracted in Examples 1 and 2, deionized water, forward and reverse primers for amplifying exon 9 of PIK3CA gene (see Table 1 for details), PCR machine, 1% agarose gel Gel, electrophoresis apparatus.
[0050] Table 1
[0051] Primer name
sequence (5'-3')
For-SEQ ID NO:3
AGGGTTTTTCCCAGTCACG TGCTTTTTCTGTAAATCATCTGTG
Rew-SEQ ID NO:4
AAACAGAGAATCTCCATTTTAGCACTT
[0052] 2. Experimental method
[0053] 2.1 Select DNA samples with better quality in Examples 1 and 2, including 88 cases of breast cancer tissue DNA, 19 cases of breast cancer paracancerous tissue DNA, and 22 cases of normal human blood sample DNA;
[0054] 2.2 Configure the PCR reaction system in the following table:
[0055] Table 2
[0056] 2×Pfu Mix
12.5μL
For (5μM)
1μL
Rew (5μM)
1μL
DNA t...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



