A kind of complex bacterial flora for heavy metal sewage treatment and its treatment process
A technology for complex bacterial flora and sewage treatment, applied in the field of complex flora and its treatment process, can solve the problems of low treatment efficiency and large amount of bacterial solution, and achieve the effect of improving treatment efficiency, reducing treatment cost, and strong ability to remove heavy metals
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] In this example, the complex flora provided by the present invention is used to adsorb heavy metal sewage. The entire adsorption process lasts for about 10 minutes, and the electron microscope observation is carried out at the same time:
[0038] see figure 1 As shown, it is the electron micrograph of the complex bacterial flora at the initial stage of adsorption. It can be seen from the electron micrograph that the initial state of the bacteria is mostly dispersed individuals and short rod-shaped bamboo joints;
[0039] figure 2 with image 3 This is the electron micrograph of the complex bacterial flora in the middle stage of adsorption. It can be seen from the figure that while the heavy metal adsorption is being carried out, the bacillus cells are connected end to end to gradually form a strip-like bacterial chain, which is presumably due to the adsorption of heavy metal ions on the cell surface. The surface charge effect or the change of the chemical properties ...
Embodiment 2
[0043] Carry out 16SrDNA sequence identification respectively to 4 strain bacterial classifications provided by the present invention, 16S rDNA is the most useful and the most commonly used molecular clock in the taxonomic research of bacterium, and its kind is few, and content is big (accounting for 80% of bacterial RNA content), The molecular size is moderate, and it exists in all organisms. Its evolution has good clock properties, and its structure and function are highly conserved, including the following steps:
[0044] Step 1: Select a single bacterial species for cultivation, and extract the bacterial genome after cultivation and expansion;
[0045] Step 2: Perform PCR amplification on the 16S rDNA sequence of the bacterial genome using 16S rDNA primers, the 16S rDNA primers used are 16S-F: AGAGTTTGATCCTGGCTCAG, 16S-R: ACGGCTACCTTGTTACGACTT;
[0046] Step 3: purifying the PCR product;
[0047] Step 4: Obtain the 16SrDNA sequence by DNA sequencing;
[0048] Step 5: Com...
Embodiment 3
[0056] This embodiment is used to illustrate the complex flora treatment process of the heavy metal sewage treatment provided by the present invention, comprising the following steps:
[0057] Step 1: Prepare bean sprouts juice medium, and co-inoculate at least one strain of Brevibacterium halotolerans strain CAS17, Bacillus sp.4014, Bacillus megaterium NBRC and Bacillus sp.1 PPL-SC1 In the bean sprouts juice culture medium, pass the filtered and sterilized air into the culture medium through the air pump, shake on the shaker for 48 hours, the rotation speed is 200rpm, and the culture temperature is 30°C, until the treated bacteria liquid is golden yellow and viscous, which is the best;
[0058] Step 2: Detect the heavy metal content in the heavy metal wastewater to be treated, dilute with water according to the volume of the heavy metal wastewater, dilute the total heavy metal content to below 1000mg / L, add the same volume of treatment bacteria solution to the diluted heavy me...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


