Unlock instant, AI-driven research and patent intelligence for your innovation.

A kind of emsa method and its probe and the preparation method of the probe

A probe and linker sequence technology, which is applied to the EMSA method and the probe and the preparation field of the probe, can solve the problems of the proportion of double-stranded probes affecting the development of positive results, the difficulty of guaranteeing the proportion of double-stranded probes, and false negatives. , to achieve the effect of shortening the marking time, reducing the preparation cost and overcoming the development error

Active Publication Date: 2018-09-25
GUANGZHOU BIOSENSE BIOSCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The synthesis method of the above-mentioned EMSA probes has three obvious disadvantages: (1) the ratio of double-stranded probes obtained by renaturation is difficult to guarantee, which may easily cause false negatives in experimental results; (2) single-stranded probes with incomplete renaturation The development brightness of the probe is much higher than the development brightness of the protein-DNA complex binding band, resulting in false negatives, and the low proportion of double-stranded probes affects the development of positive results; (3) a large number of single-stranded probes need to be synthesized, higher cost

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of emsa method and its probe and the preparation method of the probe
  • A kind of emsa method and its probe and the preparation method of the probe
  • A kind of emsa method and its probe and the preparation method of the probe

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1, SMAD2

[0043] S1. Preparation of template chain

[0044] The transcription factor binding sequence was directly determined according to the SMAD2 sequence of HOCOMOCO or JASPAR database, and the obtained transcription factor binding sequence was GTGTCHGKCTR (H=A / C / T; K=G / T; R=A / G). A linker sequence (GGGTCTAGACCC, SEQ ID NO: 1) was added to the 5' and 3' ends of the transcription factor binding sequence to obtain a template strand (linker sequence + transcription factor binding sequence + linker sequence, GGGTCTAGACCC+GTGTCHGKCTR+GGGTCTAGACCC, SEQ ID NO: 4), its structure is as figure 1 As shown, the sequence was sent to Gene Synthesis Company for synthesis. Simultaneously, a mutant single chain was synthesized with the sequence GGGTCTAGACCC+TCGRTTHGKCG+GGGTCTAGACCC (SEQ ID NO: 7).

[0045] S2. Synthetic primers

[0046] Chemically synthesize biotin-labeled and LNA-modified primers. The nucleotide sequence of the primer is the same as that of the linker ...

Embodiment 2

[0079] Embodiment 2, NFKB3

[0080] According to the NFKB3 sequence of HOCOMOCO or JASPAR database, the transcription factor binding sequence was directly determined, and the obtained transcription factor binding sequence was AGTTGGAAATYCCTCCCAGGC. A linker sequence (GCATCATGATGC, SEQ ID NO: 2) was added to the 5' and 3' ends of the transcription factor binding sequence to obtain a template strand (linker sequence + transcription factor binding sequence + linker sequence, GCATCATGATGC+AGTTGGAAATYCCTCCCAGGC+GCATCATGATGC, SEQ ID NO: 5). The sequence was sent to Gene Synthesis Company for synthesis. Simultaneously, a mutant single chain was synthesized, the sequence of which was GCATCATGATGC+AGCTAGYCTGACATCACGCTG+GCATCATGATGC (SEQ ID NO: 12).

[0081] The methods of synthesizing primers, PCR amplification and synthesizing double-stranded probes and EMSA in this example are the same as those in Example 1. The sequence of the primer modified by LNA is GcATcATgATgC (lowercase let...

Embodiment 3

[0086] Example 3, C-JUN

[0087] The transcription factor binding sequence was directly determined according to the C-JUN sequence of HOCOMOCO or JASPAR database, and the obtained transcription factor binding sequence was TCCGTGTTCTGACTCTTGAGGGTCTTC. A linker sequence (GGGCTAGCCC, SEQ ID NO: 3) was added to the 5' and 3' ends of the transcription factor binding sequence to obtain a template strand (linker sequence + transcription factor binding sequence + linker sequence, GGGCTAGCCC+TCCGTGTTCTGACTCTTGAGGGTCTTC+GGGCTAGCCC, SEQ ID NO: 6). The sequence was sent to Gene Synthesis Company for synthesis. Simultaneously synthesize a mutant single chain, the specific sequence of which is GGGCTAGCCC+TCCTCGTCGTGTCAGTGGTCTTATGTC+GGGCTAGCCC (SEQ ID NO: 17).

[0088] The method of synthesizing primers and PCR amplification and synthesizing double-stranded probes in this example is the same as that in EMSA Example 1, but the sequences are different. The sequence of the primer modified by...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an EMSA method, a probe thereof and a preparation method of the probe. The EMSA probe comprises a first strip chain, and the first strip chain comprises a transcription factor combination sequence and joint sequences located at the 5' end and the 3' end of the transcription factor combination sequence. The preparation method of the EMSA probe comprises the following steps of synthesizing a template strand and a primer which is labeled through biotin and modified through LNA, wherein the template strand contains the transcription factor combination sequence and the joint sequences located at the 5' end and the 3' end of the transcription factor combination sequence, each joint sequence is a palindromic sequence, and the nucleotide sequence of the primer is the same as the nucleotide sequence of each joint sequence; adopting the primer for conducting PCR amplification with the template strand as the template and synthesizing the EMSA probe . The EMSA probe can be used for conducting EMSA. According to the EMSA method, the probe thereof and the preparation method of the probe, the double-stranded probe is prepared from a single-strained probe through PCR, false negativeness due to incomplete renaturation is avoided, and developing errors caused by the single-stranded free probe are further overcome.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to an EMSA method, a probe and a preparation method of the probe. Background technique [0002] Gel shift or electrophoretic mobility shift assay (EMSA) is a classic method for studying promoter-binding proteins and a technique for qualitative and quantitative analysis of nucleic acid-protein interactions. The basic process of EMSA is to 32 P or 33 P-labeled or non-radioactively labeled DNA fragments containing specific DNA sites are co-incubated with DNA-binding proteins for electrophoresis analysis. Protein-DNA complexes are separated from free DNA by EMSA, and proteins hinder the binding of DNA fragments to which they bind. mobility. Therefore, free DNA moves faster than DNA-protein complexes, and images of the gel can reveal the location of free and bound labeled DNA. EMSA is not only simple, rapid, and highly sensitive; it can also use competition assays to evaluate the binding...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6804C12Q1/6811C12N15/11C12N15/10G01N33/53G01N33/561
CPCC12Q1/6804C12Q1/6811G01N33/5308G01N33/561C12Q2525/191C12Q2565/125C12Q2531/113
Inventor 董先辉王晓香曾健张娟杨嘉杰周剑
Owner GUANGZHOU BIOSENSE BIOSCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More