EMSA method, probe thereof and preparation method of probe

A technology of probe and linker sequence, which is applied in the field of EMSA method and its probe and the preparation of the probe, which can solve the problems that the ratio of double-stranded probes affects the development of positive results, the ratio of double-stranded probes is difficult to guarantee, and the cost is high. Achieve the effects of shortening marking time, reducing preparation costs, and overcoming development errors

Active Publication Date: 2016-04-20
GUANGZHOU BIOSENSE BIOSCI
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The synthesis method of the above-mentioned EMSA probes has three obvious disadvantages: (1) the ratio of double-stranded probes obtained by renaturation is difficult to guarantee, which may easily cause false negatives in experimental results; (2) single-stranded probes with incomplete renaturation The development brightness of the probe is much higher than the development brightness of the protein-DNA complex binding band, resulting in false negatives, and the low proportion of double-stranded probes affects the development of positive results; (3) a large number of single-stranded probes need to be synthesized, higher cost

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • EMSA method, probe thereof and preparation method of probe
  • EMSA method, probe thereof and preparation method of probe
  • EMSA method, probe thereof and preparation method of probe

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Embodiment 1, SMAD2

[0043] S1. Preparation of template chain

[0044] The transcription factor binding sequence was directly determined according to the SMAD2 sequence of the HOCOMOCO or JASPAR database, and the obtained transcription factor binding sequence was GTGTCHGKCTR (H=A / C / T; K=G / T; R=A / G). A linker sequence (GGGTCTAGACCC, SEQ ID NO: 1) was added to the 5' and 3' ends of the transcription factor binding sequence, respectively, to obtain a template chain (linker sequence + transcription factor binding sequence + linker sequence, GGGTCTAGACCC + GTGTCHGKCTR + GGGTCTAGACCC, SEQ ID NO: 4) , whose structure is as figure 1 shown, the sequence was sent to a gene synthesis company for synthesis. At the same time, a mutant single chain was synthesized, and the sequence was GGGTCTAGACCC+TCGRTTHGKCG+GGGTCTAGACCC (SEQ ID NO: 7).

[0045] S2. Synthetic primers

[0046] Chemical synthesis of biotin-labeled and LNA-modified primers, the nucleotide sequence of the primer i...

Embodiment 2

[0079] Example 2, NFKB3

[0080] The transcription factor binding sequence was directly determined according to the NFKB3 sequence of HOCOMOCO or JASPAR database, and the obtained transcription factor binding sequence was AGTTGGAAATYCCTCCCAGGC. A linker sequence (GCATCATGATGC, SEQ ID NO: 2) was added to the 5' and 3' ends of the transcription factor binding sequence, respectively, to obtain a template chain (linker sequence + transcription factor binding sequence + linker sequence, GCATCATGATGC + AGTTGGAAATYCCTCCCAGGC + GCATCATGATGC, SEQ ID NO: 5) . The sequence was sent to a gene synthesis company for synthesis. At the same time, a mutant single chain was synthesized, the sequence of which was GCATCATGATGC+AGCTAGYCTGACATCACGCTG+GCATCATGATGC (SEQ ID NO: 12).

[0081] The methods of synthesizing primers, PCR-amplified synthesizing double-stranded probes and EMSA in this example are the same as those in Example 1. The LNA-modified sequence of the primer is GcATcATgATgC (lower...

Embodiment 3

[0086] Embodiment 3, C-JUN

[0087] The transcription factor binding sequence was directly determined according to the C-JUN sequence of the HOCOMOCO or JASPAR database, and the obtained transcription factor binding sequence was TCCGTGTTCTGACTCTTGAGGGTCTTC. A linker sequence (GGGCTAGCCC, SEQ ID NO: 3) was added to the 5' and 3' ends of the transcription factor binding sequence, respectively, to obtain a template chain (linker sequence + transcription factor binding sequence + linker sequence, GGGCTAGCCC+TCCGTGTTCTGACTCTTGAGGGTCTTC+GGGCTAGCCC, SEQ ID NO: 6) . The sequence was sent to a gene synthesis company for synthesis. At the same time, a mutant single chain was synthesized, and the specific sequence of the mutant single chain was GGGCTAGCCC+TCCTCGTCGTGTCAGTGGTCTTATGTC+GGGCTAGCCC (SEQ ID NO: 17).

[0088] The method for synthesizing primers, PCR amplification and synthesizing double-stranded probes in this example is the same as that in EMSA Example 1, but the sequences a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses an EMSA method, a probe thereof and a preparation method of the probe. The EMSA probe comprises a first strip chain, and the first strip chain comprises a transcription factor combination sequence and joint sequences located at the 5' end and the 3' end of the transcription factor combination sequence. The preparation method of the EMSA probe comprises the following steps of synthesizing a template strand and a primer which is labeled through biotin and modified through LNA, wherein the template strand contains the transcription factor combination sequence and the joint sequences located at the 5' end and the 3' end of the transcription factor combination sequence, each joint sequence is a palindromic sequence, and the nucleotide sequence of the primer is the same as the nucleotide sequence of each joint sequence; adopting the primer for conducting PCR amplification with the template strand as the template and synthesizing the EMSA probe . The EMSA probe can be used for conducting EMSA. According to the EMSA method, the probe thereof and the preparation method of the probe, the double-stranded probe is prepared from a single-strained probe through PCR, false negativeness due to incomplete renaturation is avoided, and developing errors caused by the single-stranded free probe are further overcome.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to an EMSA method and a probe thereof and a preparation method of the probe. Background technique [0002] Gel shift or electrophoretic mobility shift assay (EMSA) is a classic method to study promoter-binding proteins, and is a technique for qualitative and quantitative analysis of nucleic acid-protein interactions. The basic process of EMSA is to 32 P or 33 P-labeled or non-radioactively labeled DNA fragments containing specific DNA sites were incubated with DNA-binding proteins for electrophoresis analysis. The protein-DNA complexes were separated from free DNA by EMSA, and the proteins hindered the binding of DNA fragments to them. mobility. Thus, free DNA moves faster than DNA-protein complexes, and images of the gel can reveal the location of free and bound labeled DNA. EMSA is not only simple, rapid, and highly sensitive; it can also use competitive assays to evaluate the bin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11C12N15/10G01N33/53G01N33/561
CPCC12Q1/6804C12Q1/6811G01N33/5308G01N33/561C12Q2525/191C12Q2565/125C12Q2531/113
Inventor 董先辉王晓香曾健张娟杨嘉杰周剑
Owner GUANGZHOU BIOSENSE BIOSCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap