Unlock instant, AI-driven research and patent intelligence for your innovation.

Genetic recombinant human C-peptide fused protein and preparation method and application thereof

A fusion protein and gene recombination technology, which is applied in the fields of genetic engineering technology, immune detection, and antibody preparation, and can solve problems such as the inability to obtain anti-C peptide-specific antibodies.

Active Publication Date: 2016-05-25
NINGBO MEDICAL SYSTEM BIOTECHNOLOGY CO LTD
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

(4) C-peptide has no biological activity, but has strong species specificity, and has no cross-immune reaction with anti-insulin
[0005] Direct immunization with C-peptide cannot obtain anti-C-peptide-specific antibodies, and it is also difficult to obtain high-affinity specific antibodies by adding general carrier proteins such as bovine serum albumin (BSA) and hemocyanin (KLH)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetic recombinant human C-peptide fused protein and preparation method and application thereof
  • Genetic recombinant human C-peptide fused protein and preparation method and application thereof
  • Genetic recombinant human C-peptide fused protein and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0057] Optimize the yeast codon preference for the two designed gene sequences, and the optimization result is:

[0058] LCMVs (167-224) gene (SEQ ID NO: 5):

[0059] ACTATCCAATACAACTTGACTTTCTCTGACAGACAATCTGCTCAATCTCAATGTAGAACTTTCAGAGGTAGAGTTTTGGACATGTTCCGTACTGCGTTCGGTGGTAAGTACATGAGATCTGGTTGGGGTTGGACTGGTTCTGACGGTAAGACTACTTGGTGTTCTCAAACTTCT

[0060] C-peptide gene SEQ ID NO: 6:

[0061] GAAGCTGAAGACTTGCAAGTTGGTCAAGTTGAATTGGGTGGTGGTCCAGGCGCGGGTAGCTTGCAACCATTGGCGTTGGAAGGTTCTTTGCAA

[0062] The above two genes were synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd. using conventional artificial methods. The synthesized genes were delivered in the form of plasmids, namely: LCMVs(167-224)-PUC57 and C-peptide-PUC57.

[0063] Design primer L 1 and L 2 , synthesized by a commercial company, its sequence is shown in SEQ ID NO: 7 and SEQ ID NO: 8 below.

[0064] L 1 SEQ ID NO:7:5'TACGTA CACCATCACCAT CATACTAT CCAATAC 3′

[0065] L 2 SEQ ID NO: 8: 5' AGAAGTTTTGAG3′

[00...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Provided are a genetic recombinant human C-peptide fused protein and a preparation method and application thereof. The fused protein is formed by serially connecting 58 amino acids from the amino acid fragment 167 to the amino acid fragment 224 of a lymphocytic choriomeningitis virus S fragment, namely LCMVs (167-224) with 31 amino acids of a complete sequence of a human C peptide. The LCMVs (167-224) is located at the terminal N of the fused protein, and the complete sequence of the human C peptide is located at the terminal C of the fused protein. The LCMVs (167-224) amino acid sequence is the amino acid sequence shown as SEQ ID NO: 1, and the amino acid sequence of the human C peptide is the amino acid sequence shown as SEQ ID NO: 2. The immune reaction capacity of the fused protein is stronger than that of a coupling BSA or KLH stimulated rat, the obtained antiserum of the immune rat has higher titer for the C peptide, a high-affinity C-peptide antibody is more easily prepared for immunological detection, and the genetic recombinant human C-peptide fused protein has a good application prospect in the fields of antibody preparation, immunological detection and the like.

Description

Technical field [0001] The present invention involves a gene-reorganized human C peptide fusion protein (C peptide fusion protein), which is specifically a gene reorganized human C peptide fusion protein (167-224) -C peptide and its preparation methods and applications.Technology, antibody preparation, immune detection and other fields. Background technique [0002] C peptide (human C peptide) refers to the original insulin (consisting of 86 amino acids, 9000 Dalton molecular weight, its structure is composed of two parts: insulin and connecting peptideMicro bubbles enter Gorkya. When the insulin primer is used to decompose, the four amino acids such as CA1 lysine, CA2 arginine, BC1 arginine, and BC2 arginine that are connected to the AB two chains of insulin31 amino acids of amino acids formed. [0003] A normal person is discharged in the 24h urine to 36 ± 4 μg.Those with young diabetes are 1.1 ± 0.5 μg; adult diabetes are 24 ± 7 μg.C -peptide removal rate has no obvious relati...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/62C12N15/81C12N1/19C07K16/26C07K16/06G01N33/68C12R1/84
CPCC07K14/005C07K14/62C07K16/06C07K16/26C07K2319/00C12N15/62C12N15/815C12N2760/10022G01N33/6854
Inventor 邹炳德邹继华李富勇祝快昌
Owner NINGBO MEDICAL SYSTEM BIOTECHNOLOGY CO LTD