Multifunctional xylan degrading enzyme derived from animal feces metagenomics, its encoding gene and its preparation method
A technology of xylan degrading enzymes and metagenomics, which is applied in the fields of botany equipment and methods, biochemical equipment and methods, plant gene improvement, etc., can solve the problems of limiting the universality and effectiveness of screening, and achieve a wide application prospect Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0060] Example 1 Extraction of Yunnan snub-nosed monkey feces microbial metagenomic DNA
[0061]Use the QIAamp DNA Stool Mini Kit (QIAGEN) kit to extract fecal microbial metagenomic DNA. For the extraction method, refer to the kit manual and make changes. The specific operations are as follows:
[0062] 1) Take out the feces sample, wash it twice with sterilized water, weigh 0.2 g of feces, and place it in a 5 mL sterilized centrifuge tube.
[0063] 2) Add 1.4mL of ASL buffer, shake and vortex until fully mixed, incubate at 70°C for 5min, then shake for 15s.
[0064] 3) Centrifuge at 12 000 rpm for 1 min, and transfer the supernatant to a clean centrifuge tube.
[0065] 4) Add 1 piece of Inhibit EX Tablet, mix thoroughly and then stand at room temperature for 2 minutes to ensure that the Inhibit EX matrix has completely adsorbed the inhibitor, and centrifuge at 12 000 rpm for 5 minutes.
[0066] 5) Transfer the supernatant to a new centrifuge tube, and centrifuge at 12 000 r...
Embodiment 2
[0073] Cloning of Example 2 Xylan Degrading Enzyme Gene XynRBM
[0074] Break 5 μg of the microbial metagenomic DNA obtained in Example 1 into 400-600 bp fragments with an ultrasonic breaker Biorupter, and purify the broken DNA fragments with the Genomic DNA Clean&Concentration kit, and then use TureseqTM DNA Sample Preparation Kit for purification Filling in the ends of the DNA fragments, adding A bases and adapters to the 3' end, and PCR amplification of the DNA fragments (operations were carried out according to the instructions of the kit). Genome sequencing was performed on the above-prepared library using a Hiseq genome sequencer (Illumima).
[0075] The data obtained from genome sequencing were functionally annotated and compared with local BLAST to obtain the xylan degrading enzyme gene XynRBM, the gene sequence of which is shown in SEQ ID NO.1.
Embodiment 3
[0076] Embodiment 3: the preparation of recombinant multifunctional xylan degrading enzyme XynRBM
[0077] With the upstream primer shown in SEQ ID NO.3 and the downstream primer shown in SEQ ID NO.4 as a primer pair, the microbial metagenomic DNA obtained in Example 1 is a template for PCR amplification, wherein the sequence of the upstream primer is : 5'ATGAACGGAAGAACTTTAAAAAC3'; the sequence of the downstream primer is: 5'AATTATAATTTCAAGCAGTTTATC3'. The PCR reaction parameters are: 94°C pre-denaturation for 5min; 94°C denaturation for 30S, 65°C for 30S, 72°C extension for 1min30S, a total of 15 cycles; 94°C denaturation for 30S, 50°C annealing for 30S, 72°C extension for 1min30S, a total of 25 cycles ; Extend 7 minutes after amplification at 72°C; where the temperature is decreased by 1°C for each cycle from 65°C to 50°C. As a result of PCR, the target gene XynRBM was obtained, and a protruding A base was introduced at the 3' end of the gene.
[0078] The gene XynRBM and ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More