Method for preparing RNA probe by template of miR-196a precursor

A technology of RNA probe and RNA polymerase, which is applied in the field of preparation of RNA probes, can solve the problem of low surgical resection rate of pancreatic cancer, achieve low background signal interference, strong specificity and stability, and enhance probe specificity Effect

CN105624150AInactive Publication Date: 2016-06-01GUANGZHOU FULENGEN
3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Publication Date
2016-06-01
Estimated Expiration
Not applicable · inactive patent

Smart Images

  • Figure 1
    Figure 1
  • Figure 2
    Figure 2
  • Figure 3
    Figure 3
Patent Text Reader

Abstract

The invention relates to a method for preparing RNA probe by template of miR-196a precursor. The method includes (1), designing at least a pair of primers according to miR-196a precursor sequence; (2), subjecting cDNA plasmids of the miR-196a precursor to PCR amplification by means of the primers obtained in the step (1) to obtain multiple DNA fragments, purifying the multiple DNA fragments and then mixing to form the template; (3), adding in RNA polymerase and biotin-labeled UTP for reaction, and mixing the UTP into a product to obtain the RNA probe after purifying. In the step (1), the PCR amplification products of the primers refer to multiple DNA fragments capable of covering all target sequences. The cRNA probe is capable of covering all target sequence completely. The method has the advantages that probe preparation procedure is simplified, the whole test time is shortened, probe specificity and stability is improved, background signal is weakened and flexibility is improved. Based on the method, the invention further provides a kit for rapid detection of miR-196a expression related with pancreatic cancer.
Need to check novelty before this filing date? Find Prior Art

Description

technical field

[0001] The invention belongs to the field of nucleic acid diagnosis, and in particular relates to a method for preparing an RNA probe using a miR-196a precursor as a template and an application thereof. Background technique

[0002] Fluorescence in situ hybridization (FISH) is an important non-radioactive in situ hybridization technology. Fluorescent dye-labeled specific nucleic acid probes hybridize with corresponding target DNA or RNA molecules in cells. If the detected chromosomal target DNA and The nucleic acid probes used are homologous and complementary, and the two undergo denaturation-annealing-annealing. Since the DNA molecules on the chromosome are arranged linearly along the longitudinal axis of the chromosome, the probes can directly hybridize with the chromosome so that the specific Genes are located on chromosomes. By observing the fluorescent signal under a fluorescent microscope to determine the location of the DNA region or RNA molecule in t...

Examples

Embodiment 1

[0041] Example 1: Preparation of RNA probes using miR-196a precursor as a template

[0042] The process of preparing RNA probes using miR-196a precursor as a template can be found in figure 1 .

[0043] 1. Design of PCR primers:

[0044] (1) Find the name and sequence of its corresponding pre-miRNA in the miRBase database (http: / / www.mirbase.org / ), that is, the miR-196a precursor (AccessionMI0000279): HomosapiensmiR-196a-2stem-loop.

[0045] (2) Query the sequence of the corresponding pre-miRNA, and the result shows that the length of the pre-miRNA is about 100nt.

[0046] (3) Design a pair of primers.

[0047] Primer design:

[0048] Primer number

Primer name

Primer sequence

1 forward

miR-196a1F

TGCTCGCTCAGCTGATCTGT

1 reverse

miR-196a-1R

taatacgactcactatagGCCCTCGACGAAAACCGACT

[0049] The primers mentioned in the above table are only examples, and those skilled in the art can design more suitable primers according to ...