Method for preparing RNA probe by template of miR-196a precursor

A technology of RNA probe and RNA polymerase, which is applied in the field of preparation of RNA probes, can solve the problem of low surgical resection rate of pancreatic cancer, achieve low background signal interference, strong specificity and stability, and enhance probe specificity Effect

Inactive Publication Date: 2016-06-01
GUANGZHOU FULENGEN
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, surgical resection is the only curative method for the treatment of pancreatic cancer, but the rate of surgical resection of pancreatic cancer is low because of the early invasion and metastasis.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing RNA probe by template of miR-196a precursor
  • Method for preparing RNA probe by template of miR-196a precursor
  • Method for preparing RNA probe by template of miR-196a precursor

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1: Preparation of RNA probes using miR-196a precursor as a template

[0042] The process of preparing RNA probes using miR-196a precursor as a template can be found in figure 1 .

[0043] 1. Design of PCR primers:

[0044] (1) Find the name and sequence of its corresponding pre-miRNA in the miRBase database (http: / / www.mirbase.org / ), that is, the miR-196a precursor (AccessionMI0000279): HomosapiensmiR-196a-2stem-loop.

[0045] (2) Query the sequence of the corresponding pre-miRNA, and the result shows that the length of the pre-miRNA is about 100nt.

[0046] (3) Design a pair of primers.

[0047] Primer design:

[0048] Primer number

Primer name

Primer sequence

1 forward

miR-196a1F

TGCTCGCTCAGCTGATCTGT

1 reverse

miR-196a-1R

taatacgactcactatagGCCCTCGACGAAAACCGACT

[0049] The primers mentioned in the above table are only examples, and those skilled in the art can design more suitable primers according to ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for preparing RNA probe by template of miR-196a precursor. The method includes (1), designing at least a pair of primers according to miR-196a precursor sequence; (2), subjecting cDNA plasmids of the miR-196a precursor to PCR amplification by means of the primers obtained in the step (1) to obtain multiple DNA fragments, purifying the multiple DNA fragments and then mixing to form the template; (3), adding in RNA polymerase and biotin-labeled UTP for reaction, and mixing the UTP into a product to obtain the RNA probe after purifying. In the step (1), the PCR amplification products of the primers refer to multiple DNA fragments capable of covering all target sequences. The cRNA probe is capable of covering all target sequence completely. The method has the advantages that probe preparation procedure is simplified, the whole test time is shortened, probe specificity and stability is improved, background signal is weakened and flexibility is improved. Based on the method, the invention further provides a kit for rapid detection of miR-196a expression related with pancreatic cancer.

Description

technical field [0001] The invention belongs to the field of nucleic acid diagnosis, and in particular relates to a method for preparing an RNA probe using a miR-196a precursor as a template and an application thereof. Background technique [0002] Fluorescence in situ hybridization (FISH) is an important non-radioactive in situ hybridization technology. Fluorescent dye-labeled specific nucleic acid probes hybridize with corresponding target DNA or RNA molecules in cells. If the detected chromosomal target DNA and The nucleic acid probes used are homologous and complementary, and the two undergo denaturation-annealing-annealing. Since the DNA molecules on the chromosome are arranged linearly along the longitudinal axis of the chromosome, the probes can directly hybridize with the chromosome so that the specific Genes are located on chromosomes. By observing the fluorescent signal under a fluorescent microscope to determine the location of the DNA region or RNA molecule in t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/10C12Q1/68
CPCC12Q1/6806C12Q1/6841C12Q2525/207C12Q2537/143C12Q2521/119C12Q2543/10
Inventor徐学明鲁隼冯俊清
OwnerGUANGZHOU FULENGEN