4 results about "RNA Probes" patented technology

The invention provides a method suitable for high-resolution targeted capture of promoter interaction fragments of plants. The method comprises the following steps: constructing a chromatin conformation capture pre-library; designing an RNA probe which is reversely complementary with the core promoter sequence; capturing a promoter interaction fragment in the chromatin conformation capture pre-library by using an RNA probe; performing library amplification; and sequencing to obtain promoter interaction fragment information. According to the capturing method, the promoter interaction fragment is specifically captured from the high-resolution chromatin conformation capturing library through complementary pairing hybridization of RNA and DNA, and then promoter interaction fragment information is obtained. And compared with the existing capture technology, the capture efficiency is greatly improved, and the method has obvious advantages in searching far-end regulation and control elements.

The invention discloses a banana fusarium oxysporum 4 # physiological race rapid detection method based on an enzyme-mediated double-index amplification technology. The detection primer group comprises the following components: F4: AAGCTAATACGACTCACATAGGGAAACTGATCCCTCAAACCAGCGG, F6: AAGCTAATACGACACCAGCGG, F7: AAGCTAATACGACACACCAGCGG R1 is CATACTTACAAGCTTATACAAGCGTTT, and R2 is And N1 is FAM-GAAGAGUUAAACAGGAAGUGGUCAGAGA-BHQ1, and N1 is Based on an enzyme-mediated double exponential amplification technology (EmDEA), Foc4 specific gene segments are screened through genome comparison, six pairs of DNA primers and six RNA probes are designed, an optimal combination (F4R1N1) is obtained through cross screening, and a set of high-sensitivity and high-specificity detection system is developed. Experimental results show that amplification of the system is completed within 30 min under the constant temperature condition of 42 DEG C, the lowest detection limit is 0.5 pg / mu L, specificity is high, cross reaction with sibling species is avoided, and efficient technical support is provided for field early warning and port quarantine of banana fusarium wilt.

This application discloses a technique for detecting target nucleic acid molecules using an activated fluorescent RNA probe, its expression vector, and a detection method. It includes: probe design and preparation methods; labeling and detection of target nucleic acid molecules in solution samples using the probe; labeling and detection of target nucleic acid molecules in living cells using the probe; and labeling and detection of target nucleic acid molecules in immobilized cells using the probe. This invention overcomes the shortcomings of current commercially synthesized FISH and molecular beacon probes, such as their inability to be genetically encoded, difficult preparation, and high cost. It provides an efficient, simple, and rapid method to obtain activated fluorescent RNA probes for detecting target nucleic acid molecules through genetic encoding or in vitro transcription. This offers a practical tool for research on fundamental life science issues and for point-of-care and even real-time diagnosis of diseases, possessing broad scientific and social significance.

The invention relates to the technical field of medical detection, and discloses a schistosoma japonicum katsurada rapid detection method based on enzyme-mediated double-index amplification, and the method comprises the following steps: designing 6 upstream DNA primers, 6 downstream DNA primers and 6 RNA probes for a schistosoma japonicum katsurada CNUS0000103598 gene segment; collecting a to-be-detected sample; constructing a 20 [mu] L reaction system, and reacting for 30 minutes at a constant temperature of 42 DEG C; and finally, detecting a fluorescence signal in the reaction process by using a fluorescence quantitative PCR (Polymerase Chain Reaction) instrument. According to the present invention, the technical effect that the detection sensitivity reaches 14 pg / [mu] L is achieved through the dual index amplification of the EmDEA technology, i.e., DNA amplification + RNA signal amplification, and is far higher than the traditional PCR and LAMP technology, the schistosoma japonicum katsurada nucleic acid in the early infection or low-load sample can be detected, and the false negative rate is effectively reduced.