Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

9 results about "RNA Probes" patented technology

RNA probes are usually prepared by in vitro transcription (see Fig. 1 above). The RNA probe is transcribed from a linear DNA template using highly specific bacteriophage DNA-dependant RNA polymerases from the Salmonella bacteriophage SP6, and the E. coli. bacteriophages T3 and T7 (RNA polymerase T7, T3 or SP6).

Detection method and detection kit for wheat leaf blight bacteria based on enzyme-mediated double-index amplification technology

The invention discloses a wheat leaf blight bacterium detection method based on an enzyme-mediated double-index amplification technology and a detection kit thereof. The invention belongs to the technical field of biology, and particularly relates to a wheat leaf blight bacterium detection method based on an enzyme-mediated double index amplification technology and a detection kit thereof. The composition for researching and detecting wheat leaf blight bacteria comprises a primer F5, a primer R3 and an RNA probe, the nucleotide sequence of the primer F5 is shown as SEQ ID No: 5, the nucleotide sequence of the primer R3 is shown as SEQ ID No: 9, and the nucleotide sequence of the RNA probe is shown as SEQ ID No: 16. According to the present invention, based on the EmDEA technology, the specific screening design is performed on the DNA primer and the RNA probe, such that the rapid detection method of the wheat leaf blight bacteria is established, and the method has good specificity, can detect the minimum DNA content of the wheat leaf blight bacteria of 100 fg, and has application prospects.
Owner:NINGBO INST OF INSPECTION & QUARANTINE SCI & TECH (NINGBO NAT INSPECTION & QUARANTINE TRADE FACILITATION SERVICE CENT)

Method suitable for high-resolution targeted capture of promoter interaction fragment of plant

The invention provides a method suitable for high-resolution targeted capture of promoter interaction fragments of plants. The method comprises the following steps: constructing a chromatin conformation capture pre-library; designing an RNA probe which is reversely complementary with the core promoter sequence; capturing a promoter interaction fragment in the chromatin conformation capture pre-library by using an RNA probe; performing library amplification; and sequencing to obtain promoter interaction fragment information. According to the capturing method, the promoter interaction fragment is specifically captured from the high-resolution chromatin conformation capturing library through complementary pairing hybridization of RNA and DNA, and then promoter interaction fragment information is obtained. And compared with the existing capture technology, the capture efficiency is greatly improved, and the method has obvious advantages in searching far-end regulation and control elements.
Owner:PEKING UNIV

Banana fusarium oxysporum 4 # physiological race rapid detection method based on enzyme-mediated double-index amplification technology

The invention discloses a banana fusarium oxysporum 4 # physiological race rapid detection method based on an enzyme-mediated double-index amplification technology. The detection primer group comprises the following components: F4: AAGCTAATACGACTCACATAGGGAAACTGATCCCTCAAACCAGCGG, F6: AAGCTAATACGACACCAGCGG, F7: AAGCTAATACGACACACCAGCGG R1 is CATACTTACAAGCTTATACAAGCGTTT, and R2 is And N1 is FAM-GAAGAGUUAAACAGGAAGUGGUCAGAGA-BHQ1, and N1 is Based on an enzyme-mediated double exponential amplification technology (EmDEA), Foc4 specific gene segments are screened through genome comparison, six pairs of DNA primers and six RNA probes are designed, an optimal combination (F4R1N1) is obtained through cross screening, and a set of high-sensitivity and high-specificity detection system is developed. Experimental results show that amplification of the system is completed within 30 min under the constant temperature condition of 42 DEG C, the lowest detection limit is 0.5 pg / mu L, specificity is high, cross reaction with sibling species is avoided, and efficient technical support is provided for field early warning and port quarantine of banana fusarium wilt.
Owner:QIONGTAI TEACHERS COLLEGE

Activated fluorescent RNA probes, their expression vectors, and detection methods

This application discloses a technique for detecting target nucleic acid molecules using an activated fluorescent RNA probe, its expression vector, and a detection method. It includes: probe design and preparation methods; labeling and detection of target nucleic acid molecules in solution samples using the probe; labeling and detection of target nucleic acid molecules in living cells using the probe; and labeling and detection of target nucleic acid molecules in immobilized cells using the probe. This invention overcomes the shortcomings of current commercially synthesized FISH and molecular beacon probes, such as their inability to be genetically encoded, difficult preparation, and high cost. It provides an efficient, simple, and rapid method to obtain activated fluorescent RNA probes for detecting target nucleic acid molecules through genetic encoding or in vitro transcription. This offers a practical tool for research on fundamental life science issues and for point-of-care and even real-time diagnosis of diseases, possessing broad scientific and social significance.
Owner:EAST CHINA UNIV OF SCI & TECH

In-situ hybridization probe for detecting hepatitis B virus cccDNA and excluding integrated DNA interference, in-situ hybridization method and application

The invention provides an integrated DNA interference excluding in-situ hybridization probe and an in-situ hybridization method for detecting hepatitis B virus cccDNA, the in-situ hybridization probe is designed based on a Basescope detection method, and comprises an HBV cccDNA probe specifically targeting an integrated breakpoint of HBV negative chain DNA, an HBV DNA probe targeting an HBV negative chain, an HBV cccDNA probe targeting an HBV negative chain, an HBV cccDNA probe targeting an HBV negative chain, an HBV cccDNA probe targeting an HBV negative chain, and an HBV cccDNA probe targeting an HBV negative chain. The HBV RNA probe with the targeted HBV positive strand gap structure and the matched ribonuclease of the HBV RNA probe can be used for detecting cccDNA and integrating HBV DNA after being treated, and the targeting sequences of the HBV cccDNA, the HBV DNA and the HBV RNA probe are respectively shown as SEQ ID No.1 to SEQ ID No.3. The in-situ hybridization probe and the in-situ hybridization method can be applied to screening medicines for preventing or treating hepatitis B virus infection and researching the life cycle of the hepatitis B virus, so that the understanding on the characteristics of the hepatitis B virus is promoted, and the evaluation on a treatment strategy is optimized.
Owner:FUDAN UNIVERSITY

ALKBH5 preparation for promoting cell senescence mechanism and RNA epigenetic regulation cell senescence

The invention discloses an ALKBH5 preparation for promoting a cell senescence mechanism and RNA epigenetic regulation cell senescence, relates to the technical field of biological medicines, and aims to solve the technical problem that an ALKBH5 regulation cell senescence mechanism is lacked in the prior art. The mechanism is that the retention of ALKBH5 in cytoplasm can promote cell aging; and retention of ALKBH5 in cytoplasm can cause maladjustment of m6A and further cause cell aging. And ALKBH5 is gathered in cytoplasm to cause cytoplasm retention, m6A imbalance and m6A hypermethylation of Cdk2 are caused, further Cdk2 RNA instability is caused, and cell senescence is caused. The key mediating factor of ALKBH5 entering the cell nucleus is Nup62; by synthesizing an m6A-modified RNA probe and transfecting the m6A-modified RNA probe into cells, it is found that the m6A-labeled RNA can effectively reverse ALKBH5 cytoplasm aggregation; and an adeno-associated virus using ALKBH5 labeled by NLS for inhibiting cell senescence in vivo by supplementing ALKBH5 to a cell nucleus.
Owner:GUANGDONG GENERAL HOSPITAL

RNA fluorescent probe for rapidly distinguishing cancer tissue from normal tissue based on nucleolar morphological changes

An RNA fluorescent probe for rapidly distinguishing cancer tissue from normal tissue based on nucleolar morphological changes, the probe being (E)-1-(3-aminopropyl)-4-(2-(9-ethyl-9H-carbazol-3-yl)vinyl)pyridine-1-ium dibromide, abbreviated as CAPY-AP. The probe can target RNA in culture cells and normal tissue as well as cancer tissue and then display nucleolar morphology. The judging criteria of distinguishing the cancer tissue from the normal tissue based on the nucleolar morphological changes is only single and unconspicuous nucleolus in most cells of normal tissue, while the enlarged nucleoli and / or multiple nucleoli exist in many cells of cancer tissue. Compared with other existing RNA probes, the probe has super-high RNA affinity and super-high permeability, and can rapidly image the RNA and nucleoli in tissue sections. Additionally, the probe has characteristics of good membrane permeability, strong fluorescence and good photostability, and is expected to be applied in preparation of intraoperative pathological diagnostic reagents for tumors.
Owner:SHANDONG UNIV

RNA polymerase variants to increase RNA capping rate in in vitro transcription

The invention provides RNA polymerase variants capable of improving the RNA capping rate in in-vitro transcription, and relates to the technical field of biology. The wild type T7RNA polymerase is modified to obtain the T7RNA polymerase variants, compared with the wild type T7RNA polymerase, the T7RNA polymerase variants have the advantages that the catalytic performance is improved, the utilization rate of hat analogues in in-vitro co-transcription capping reaction can be increased, the use amount of the hat analogues is greatly reduced, the waste of raw materials is avoided, and the cost is reduced. The method is suitable for preparation processes of RNA vaccines, RNA drugs, RNA probes, proteins and the like, and has a wide application prospect.
Owner:NANJING VAZYME BIOTECH CO LTD

Rapid schistosoma japonicum katsurada detection method based on enzyme-mediated double-index amplification

PendingCN121802065AMicrobiological testing/measurementDNA/RNA fragmentationBiotechnologyQuantitative PCR instrument
The invention relates to the technical field of medical detection, and discloses a schistosoma japonicum katsurada rapid detection method based on enzyme-mediated double-index amplification, and the method comprises the following steps: designing 6 upstream DNA primers, 6 downstream DNA primers and 6 RNA probes for a schistosoma japonicum katsurada CNUS0000103598 gene segment; collecting a to-be-detected sample; constructing a 20 [mu] L reaction system, and reacting for 30 minutes at a constant temperature of 42 DEG C; and finally, detecting a fluorescence signal in the reaction process by using a fluorescence quantitative PCR (Polymerase Chain Reaction) instrument. According to the present invention, the technical effect that the detection sensitivity reaches 14 pg / [mu] L is achieved through the dual index amplification of the EmDEA technology, i.e., DNA amplification + RNA signal amplification, and is far higher than the traditional PCR and LAMP technology, the schistosoma japonicum katsurada nucleic acid in the early infection or low-load sample can be detected, and the false negative rate is effectively reduced.
Owner:HUBEI UNIV OF MEDICINE