Detection probe, preparation method thereof, and application

A technology for detecting probes and sequencing, which is used in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., which can solve the performance degradation of probe coverage uniformity, difficult preservation of RNA probes, and capture reactions. Cost increase and other issues, to achieve the effect of reducing experimental cost, high uniformity and low cost

Active Publication Date: 2020-11-27
广州鼓润医疗科技有限公司
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So you end up with very few probes, leading to an upward adjustment in the cost per capture reaction
The RNA probe is generally based on the amplified DNA probe, and then in vitro transcription. During the transcription process, biotin-NTP is added to prepare the RNA probe. The process from PCR to in vitro transcription can amplify the probe. Thousands of times, although the amount of probes produced is large, but some probes are lost during the operation process, resulting in a decrease in the performance of probe coverage uniformity during actual capture. On the other hand, RNA probes are not easy to store and easy to degrade
At present, the difficulty and pain point of liquid phase hybridization capture lies in the synthesis of probes, mainly due to problems such as high cost, amplification deviation, and poor coverage uniformity.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection probe, preparation method thereof, and application
  • Detection probe, preparation method thereof, and application
  • Detection probe, preparation method thereof, and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] A kind of embodiment of DNA probe prepared by the method of the present invention (the schematic diagram of the preparation principle of DNA probe is as follows figure 1 ), the preparation method is as follows:

[0042] 1. Preparation of Minicircle plasmid containing the target fragment:

[0043] (1), using primer 1: ccatgtaccaatgttgcagt (SEQ ID NO.3) and primer 2: ggatcctttgccccagtgtt (SEQ ID NO.4), by PCR method, from pBR322-HPV16 (purchased from ATCC, trade name: human papilloma virus type 16 45113 TM ) was cloned to obtain the full-length fragment of HPV16; the PCR system is shown in Table 1. KAPA HiFi Hot Start Ready Mix was purchased from Roche.

[0044] Table 1 HPV16 full-length fragment amplification PCR system

[0045] components Dosage pBR322-HPV16 plasmid 1μL Primer 1 (10 μM) 1μL Primer 2 (10 μM) 1μL KAPA HiFi Hot Start Ready Mix(2×) 25 μL water 22 μL total capacity 50μL

[0046] The reaction pr...

Embodiment 2

[0074] Embodiment 2 The method for the probe of the present invention to carry out liquid phase capture

[0075] 1. Sample preparation stage

[0076] genomic DNA fragmentation

[0077] 1) Transfer the genomic DNA to a 0.6mL MaxyClear Snap lock Microcentrifuge Tube according to the above system, mix well, centrifuge briefly and put it on ice for use;

[0078] 2) Turn on the ultrasonic interrupter Bioruptor Pico in advance. After the temperature of the cold cycler drops to 4°C, set the parameters ON30s, OFF30s as a cycle, and every 10cycles is a round, and a total of 3 rounds are performed. After each round, the sample is placed Mix well on a shaker, and then perform the next round of fragmentation after brief centrifugation (the more thoroughly the mixing, the more concentrated the size of the fragmented sample); after fragmentation, the main peak of the sample detection is about 150bp-200bp.

[0079] 2. Library Construction Phase

[0080] 1. End repair, add "A" to the 3' en...

Embodiment 3

[0144] An embodiment of RNA probe prepared by the method of the present invention (the schematic diagram of the preparation principle of RNA probe is as follows figure 1 ), except for rolling circle amplification and purification, the rest of the process is the same as in Example 1 (note: the product after RCT is RNA, and all consumables used in the experimental process, including pipette tips, centrifuge tubes, interrupted tubes, etc., need to be kept No RNase. Change gloves frequently during operation to avoid RNase contamination.).

[0145] Rolling circle amplification and purification:

[0146] Prepare the reaction system according to the table below (the relevant reagents are purchased from NEB, product number T7 RNA polymerase).

[0147] Table 11 Reaction system

[0148] components Dosage 10×T7 RNA polymerase buffer 2μL RCA primer 2.5μL Sample to be amplified 5ng Enzyme-free water Rehydrate to 14.2 μL

[0149] Incubate at 95...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a detection probe, a preparation method thereof, and application, and belongs to the field of biology. According to the preparation method disclosed, full-length probe fragments are obtained through amplification by combining minicircle plasmids with a rolling circle amplification method, and the probes with different length requirements are further prepared through ultrasonic interruption. The method can be used for producing DNA probes or RNA probes, and the preparation method is simple, the yield is high, the cost is low, and the preparation period can be shortened to one day. Besides, the lengths of the probes prepared by the method is not limited, the probes with different targets and different lengths can be provided as required, the homogeneity is good, and the purity is high, so that the capture performance of the probes is greatly improved, the sequencing uniformity and depth of a target area are better, and the experiment cost is further reduced.

Description

technical field [0001] The invention belongs to the biological field and relates to a detection probe, its preparation method and application. Background technique [0002] In the past ten years, the rapid development of NGS (next-generation sequencing technology) has greatly reduced the cost of DNA sequencing. However, at this stage, the cost of whole-genome resequencing is still high, and the analysis speed of the massive data obtained is slow, making it difficult to Applied on a large scale. Targeted sequencing technology can enrich the genomic region of interest for sequencing. The single sample sequencing data output is less and the analysis speed is faster. Therefore, it can take advantage of the advantages of NGS technology more cost-effectively and widely used in clinical testing and health screening. and many other fields. In addition, targeted sequencing can perform deep sequencing of the target region, increasing the detection sensitivity and accuracy of genetic...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6811C12Q1/6874C12N15/11
CPCC12Q1/6811C12Q1/6874C12Q2531/125C12Q2523/301C12Q2535/122C12Q2531/113Y02A50/30
Inventor程欢欢陈莹谢红娴兰凯黄龙
Owner广州鼓润医疗科技有限公司