An indigo pigment-producing fungus of the genus Botrytis and its application in printing and dyeing

A technology of botrytis and indigo pigments, applied in the fields of fungi, dyeing methods, microorganisms, etc.

Active Publication Date: 2018-10-19
LUOHE MEDICAL COLLEGE
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

About the indigo-producing Botrytis fungus Pseudofusicoccum sp. F10 and its application in printing and dyeing, there is no report

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • An indigo pigment-producing fungus of the genus Botrytis and its application in printing and dyeing
  • An indigo pigment-producing fungus of the genus Botrytis and its application in printing and dyeing
  • An indigo pigment-producing fungus of the genus Botrytis and its application in printing and dyeing

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Embodiment 1: a strain produces indigo pigment Botrytis fungus Pseudofusicoccum sp. F10 (deposit unit: China Center for Type Culture Collection; preservation time: May 12, 2015; preservation address: Luojia Mountain, Wuchang, Wuhan (Wuhan University), zip code 430072; preservation number: CCTCC NO: M 2015293, Classification belongs to Botryobacteriaceae, Botrytis genus,

[0029] A described indigo pigment-producing Botrytis fungus Pseudofusicoccum sp. F10 (deposit number: CCTCC NO: M 2015293) ， It is characterized in that the coloring of the aerial hyphae of the fungus changes from off-white to black with the growth of the fungus, and the color on the back of the petri dish (PSA, cultivated on potato sucrose agar) gradually changes from blue-gray to finally blue-black, aerial The top of the hyphae forms a capitulum, producing hyaline conidia, such as figure 1 shown.

[0030] A described indigo pigment-producing Botrytis fungus Pseudofusicoccum sp. F10 (deposit ...

Embodiment 2

[0047] Embodiment 2: a strain produces indigo pigment Botrytis fungus Pseudofusicoccum Sp. F10 (preservation number: CCTCC NO: M 2015293) bacterial fermentation broth dyeing characteristics of cotton fabrics are: cotton fabrics are dyed by post-media method in bacterial fermentation broth, dyed at 90°C for 60 minutes, cooled to 70°C, added mordant NaCl (5g / L), raise the temperature to 90°C, keep the temperature constant for 30 minutes, take out the cloth sample after cooling down to room temperature, wash with water and then dry; re-dyeing many times, the dyeing effect is good.

[0048]ACCTACCGGGATTAGGGTCTCTTCCCGAGCCCACTCTCCAACCCTTTGTGTACCTACCTCTGTTGCTTTGGCGGGCCGCGGTTCTCCGCGGCCGGCCCCCTAGCCGGGGCTGGCCTGCGCCCGCCAGAGGACCACAAAACTCCAGTCAGTGAACTTTGCTGTCTGATATAAATTCAATAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCTCTGCTTGGTATTGGGCGGCGTCCTCTCCGGACGCGCCTCAAAG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to the field of light chemical industry and aims to provide a strain Pseudofusicoccum sp. F10 of the genus Botrytis and its application in printing and dyeing. The fungus F10 can produce indigo pigment, which is a compound with C-CH3 substituents and aromatic acids. The maximum absorption peak of the pigment is located at 620nm in neutral and slightly alkaline aqueous solutions, and the pigment is precipitated in acidic aqueous solution; The oxidizing agent is not sensitive, and the reducing agent sodium sulfite can destroy the pigment; the printing and dyeing effect on cotton fabrics is good, and the mordant NaCl is helpful for the dyeing effect. The novel natural dye obtained by the invention is safe and environment-friendly, and the invention is not limited by region and environment, the reproducibility of the fungal pigment is good, and the biological cultivation method greatly increases the output, and it is easier to realize industrialization.

Description

technical field [0001] The invention relates to the field of light chemical industry, in particular to a fungus of the genus Botrytis which produces indigo pigment Pseudofusicoccum sp. F10 and its application in printing and dyeing. Background technique [0002] Pigment is a coloring agent, which is an important part of the printing and dyeing industry and food additives. It can improve the color of printed and dyed articles and food, and is one of the key factors determining product quality. The color of the product is the first sensory impression that the product gives to consumers, which directly affects the sales performance of the product. Therefore, it is very important for the product to have a safe tone and color. Pigments are generally divided into synthetic pigments and natural pigments. Although synthetic pigments occupy a dominant position in the market, with reports that synthetic pigments are toxic, carcinogenic, and may even cause damage to important organis...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/14C12P17/16D06P1/34C12R1/645
CPCC12P17/165C12N1/145C12R2001/645D06P3/60
Inventor 王飞赵丽芳罗海澜马翠云刘少阳魏永义
Owner LUOHE MEDICAL COLLEGE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap