Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Specific primer combination for identifying different species of melilotus and application of specific primer combination

A combination of primers and the technology of sweet-scented osmanthus, applied in the field of bioengineering, can solve the problems of difficult classification, difficult to clearly distinguish sweet-scented osmanthus species, mixed sweet-scented clover species, etc. The effect of identification

Active Publication Date: 2016-06-22
LANZHOU UNIVERSITY
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] However, the classification of sweet clover in production is limited to morphological characteristics and its living habits
The leaves, flower types, flower colors, seeds, and fruit pods of Melilotus plants vary greatly (Klebesadel, 1954; Moussavi, 2001), making it difficult to classify accurately
At present, the varieties of sweet-scented osmanthus in circulation in production are mixed, which is not conducive to the differentiation of germplasm resources and storage of classified storage. Therefore, it is of great significance to quickly and accurately distinguish different kinds of sweet-scented osmanthus for actual production
[0004] At present, the classification of sweet clover at the molecular level has been reported, but it is difficult to clearly distinguish all sweet clover species with only one pair of primers

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific primer combination for identifying different species of melilotus and application of specific primer combination
  • Specific primer combination for identifying different species of melilotus and application of specific primer combination
  • Specific primer combination for identifying different species of melilotus and application of specific primer combination

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Embodiment 1: A kind of specific primer combination kit for identifying different species of Melilotus genus includes:

[0037] Five combinations of basic primers ITS, psbA-trnH, rbcL, matK, trnLPCR detection system, the total volume of the PCR detection system is 25μl, including 2×ReactionMix12.25μl, GoldenDNAPolymerase0.25μl, each forward and reverse primers are 2.5μl,

[0038] ITS·F(5′·3′)GGAAGKARAAGTCGTAACAAGG

[0039] ITS·R(5′·3′)RGTTTCTTTTTCCTCCGCTTA

[0040] rbcL·F(5′·3′)AGACCTWTTTGAAGAAGGTTCWGT

[0041] rbcL·R(5′·3′)TCGGTYAGAGCRGGCATRTGCCA

[0042] matK·F(5′·3′)CCCRTYCATCTGGAAATCTTGGTTC

[0043] matK·R(5′·3′)GCTRTRATAATGAGAAAGATTCTGC

[0044] trnL·F(5′·3′)CGAAATCGGTAGACGCTACG

[0045] trnL·R(5′·3′)ATTTGAACTGGTGACACGAG

[0046] psbA·F(5′·3′)GTTATGCATGAACGTAATGCTC

[0047] trnH·R(5′·3′)CGCGCATGGTGGATTCACAAATCITS·F(5′·3′),ddH 2 05 μl;

Embodiment 2

[0048] Embodiment 2: A method for identifying different species of Melilotus genus in combination with five specific primers, the specific steps are as follows:

[0049]1) DNA extraction of seedlings: use SDS method to extract, (1) clean the whole plant after 7 days of cultivation, put the whole plant in a mortar and grind it thoroughly (2) add 600 μl DNA buffer and mix evenly, pour it into a 1.5ml centrifuge tube, and put it in a 65°C water bath 10min, shake 1-2 times during the period (3) put it to room temperature, add 195μl 15mol potassium acetate (PH=6.0), put it on ice for 5min (4) add 600μl chloroform isoamyl alcohol (24:1), mix well (5) Centrifuge at room temperature at 12000rpm for 10min, pipette 360μl of supernatant into a new 1.5ml centrifuge tube (6) add 54μl of 3mol sodium acetate and 360μl of isopropanol, mix well, leave at room temperature for 10min (7) at room temperature, centrifuge at 12000rpm for 10min, discard the supernatant And invert the 1.5ml centrifuge...

Embodiment 3

[0058] Example 3: A method for verifying the accuracy of five specific primer combinations for identifying different species of Melilotus genus:

[0059] In order to verify the accuracy of the specific primer combinations, 20 individual plants of 5 different materials were randomly selected and sequenced according to the steps in Example 2 (single plant DNA sequencing), the resulting sequences were spliced ​​according to five combinations, and then combined with the corresponding combinations A phylogenetic tree was constructed by clustering, and as a result, more than 90% of each material (Melilotus clover is a cross-pollinated plant) can be gathered into the same species, such as Figure 6 .

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses specific primer combination for identifying different species of melilotus and an application of the specific primer combination. Five pairs of primers are provided. A use method comprises steps as follows: the five pairs of primers are sequenced, edited, integrated and unified, corresponding sequences are connected end to end and spliced together in different combination manners, MEGA6.0 software is used for splicing sequences, and a tree is established. With the utilization of the specific primer combination, 89.7% of 39 parts of materials of 18 types of tested melilotus are distinguished. An identification result proves that the method is rapid, efficient, high in resolving ability and good in accuracy, can rapidly and accurately distinguish different species of melilotus and has very high applicability and economic value.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and relates to a specific primer for identifying different species of Melilotus genus and its application. Background technique [0002] Melilotus is a leguminous herbaceous plant, annual or biennial, cross-pollinated. There are about 19 species in the world, and sweet-scented osmanthus mainly grows in Inner Mongolia, Liaoning, Gansu, Shaanxi and other places in China (Stevenson, 1969). Sweet clover has strong adaptability, can tolerate cold, drought, salinity, and barrenness (Ma Li, 2005), can not only prevent wind and fix sand, but also maintain water and soil. It has the functions of invigorating the stomach and removing dampness, clearing heat and detoxifying (Zhu Wenmei, 2008). In addition, sweet clover has a strong ability to fix nitrogen, which is beneficial to crop rotation. [0003] However, the classification of sweet clover in production is limited to morphological characteri...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6895
Inventor 吴凡张吉宇骆凯张代玉郭文丽白荣张红祥王彦荣
Owner LANZHOU UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com