Specific primer combination for identifying different species of melilotus and application of specific primer combination
A combination of primers and the technology of sweet-scented osmanthus, applied in the field of bioengineering, can solve the problems of difficult classification, difficult to clearly distinguish sweet-scented osmanthus species, mixed sweet-scented clover species, etc. The effect of identification
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Embodiment 1: A kind of specific primer combination kit for identifying different species of Melilotus genus includes:
[0037] Five combinations of basic primers ITS, psbA-trnH, rbcL, matK, trnLPCR detection system, the total volume of the PCR detection system is 25μl, including 2×ReactionMix12.25μl, GoldenDNAPolymerase0.25μl, each forward and reverse primers are 2.5μl,
[0038] ITS·F(5′·3′)GGAAGKARAAGTCGTAACAAGG
[0039] ITS·R(5′·3′)RGTTTCTTTTTCCTCCGCTTA
[0040] rbcL·F(5′·3′)AGACCTWTTTGAAGAAGGTTCWGT
[0041] rbcL·R(5′·3′)TCGGTYAGAGCRGGCATRTGCCA
[0042] matK·F(5′·3′)CCCRTYCATCTGGAAATCTTGGTTC
[0043] matK·R(5′·3′)GCTRTRATAATGAGAAAGATTCTGC
[0044] trnL·F(5′·3′)CGAAATCGGTAGACGCTACG
[0045] trnL·R(5′·3′)ATTTGAACTGGTGACACGAG
[0046] psbA·F(5′·3′)GTTATGCATGAACGTAATGCTC
[0047] trnH·R(5′·3′)CGCGCATGGTGGATTCACAAATCITS·F(5′·3′),ddH 2 05 μl;
Embodiment 2
[0048] Embodiment 2: A method for identifying different species of Melilotus genus in combination with five specific primers, the specific steps are as follows:
[0049]1) DNA extraction of seedlings: use SDS method to extract, (1) clean the whole plant after 7 days of cultivation, put the whole plant in a mortar and grind it thoroughly (2) add 600 μl DNA buffer and mix evenly, pour it into a 1.5ml centrifuge tube, and put it in a 65°C water bath 10min, shake 1-2 times during the period (3) put it to room temperature, add 195μl 15mol potassium acetate (PH=6.0), put it on ice for 5min (4) add 600μl chloroform isoamyl alcohol (24:1), mix well (5) Centrifuge at room temperature at 12000rpm for 10min, pipette 360μl of supernatant into a new 1.5ml centrifuge tube (6) add 54μl of 3mol sodium acetate and 360μl of isopropanol, mix well, leave at room temperature for 10min (7) at room temperature, centrifuge at 12000rpm for 10min, discard the supernatant And invert the 1.5ml centrifuge...
Embodiment 3
[0058] Example 3: A method for verifying the accuracy of five specific primer combinations for identifying different species of Melilotus genus:
[0059] In order to verify the accuracy of the specific primer combinations, 20 individual plants of 5 different materials were randomly selected and sequenced according to the steps in Example 2 (single plant DNA sequencing), the resulting sequences were spliced according to five combinations, and then combined with the corresponding combinations A phylogenetic tree was constructed by clustering, and as a result, more than 90% of each material (Melilotus clover is a cross-pollinated plant) can be gathered into the same species, such as Figure 6 .
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com