Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer, kit and method for detecting swine chlamydiosis

A technique for porcine chlamydia disease and porcine chlamydia, which is applied in the field of molecular biology, can solve the problems of large subjective influence, low separation rate, and large deviation of results, and achieve the effects of fast detection, simple operation, and high sensitivity

Inactive Publication Date: 2016-07-13
WENS FOOD GRP CO LTD
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Giemsa staining microscopic examination method is subject to subjective influence, and the result deviation is large
However, the isolation of pathogens is time-consuming and labor-intensive, and the isolation rate is low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer, kit and method for detecting swine chlamydiosis
  • Primer, kit and method for detecting swine chlamydiosis
  • Primer, kit and method for detecting swine chlamydiosis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Example 1 detects primers and methods for swine chlamydiosis

[0023] 1, Primer design

[0024] According to the Chlamydia psittaci MOMP (majoroutermembraneprotein) gene sequence registered by NCBI (accession numbers: AB468956, KM609426, CP003790, EU856033, CP002807, CP002805, CP002586, FQ482149) for comparison, and designed Chlamydia psittaci PCR primers, respectively F1, R1.

[0025] F1: TCCTTACAAGCCTTGCCTGTAGG (SEQ ID NO: 1)

[0026] R1: AGCGTATTGGAAYTCRGCTC (SEQ ID NO: 2)

[0027] Among them, the merged base code: Y=C / T, R=A / G

[0028] 2, Detection method

[0029] Include the following steps:

[0030] (1) Genomic DNA extraction from pig samples to be tested

[0031] DNA / RNA Mini Kit from Aisigen Biotechnology (Hangzhou) Co., Ltd. was used. 100mg of freshly aborted fetal lungs (No. 3), lymph nodes (No. 4), vaginal secretions from aborted sows (No. 5), joint capsule fluid of piglets with polyarthritis (No. 6).

[0032] Add 1mL of LPBS buffer for thorough g...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a primer, a kit and a method for detecting swine chlamydiosis. The primer is shown in SEQ ID No:1 and SEQ ID No.2, and the method comprises the step of carrying out PCR amplification reaction and electrophoretic analysis by taking a to-be-detected pig sample genome DNA as a template. The primer for detecting the swine chlamydiosis can specifically amplify chlamydia psittaci and is unresponsive to other common pathogens; the method has high sensitivity and can conveniently and quickly detect the chlamydia psittaci of various clinical pig samples, specific prevention and control measures can be beneficially rapidly taken, and operation is simple and practical.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and more specifically, the invention relates to a primer, a kit and a method for detecting swine chlamydial disease. Background technique [0002] Chlamydia is a class of microorganisms between bacteria and viruses, with a diameter of 0.2 μm to 1.5 μm. It can only reproduce with a developmental history inside the protoplasm of the host cell. This developmental history is characterized by the transformation of small protoplasms into larger reticulums. The reticulums reproduce by division, and the reticulums rupture after maturation, releasing a large number of protoplasma. Protomers are infectious, but reticulum has no infectivity to new host cells. Gram stain for Chlamydia psittaci was negative. The structure and composition of the cell wall are similar to those of other Gram-negative bacteria, but there is only trace or no muramic acid. [0003] Pig chlamydial disease is mainly caus...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11C12R1/01
CPCC12Q1/689
Inventor 欧阳海平宋爽潘永飞王东东蔡新斌宋延华
Owner WENS FOOD GRP CO LTD
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More