Construction method and application of NK (natural killer) cell activation testing receptor signal path NKG2D fluorescence report system
A reporter system and signaling pathway technology, which can be used in the establishment and application of cell models, and can solve problems such as NKG2D expression methods that have not yet been studied.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0034] Reagent source:
[0035] DMEM high-glucose medium and 1640 medium are commercial products, purchased from Hiclone Company; newborn bovine serum is a commercial product, purchased from Gibco Company; primers were synthesized by Huada Gene; high-efficiency transfection reagent PolyJet was purchased from SignaGen Company; PE Labeled NKG2D monoclonal antibody and FITC-labeled human DAP12 monoclonal antibody were purchased from BD Company; recombinant soluble MICA and MICB proteins were prepared by our laboratory.
[0036] Strains, vectors, and cell sources:
[0037] Escherichia coli DH5α was purchased from Takara Company, plasmids pLXSN16E6E7 and pCL-Eco were purchased from Addgene, HEK293T cells, and 3A9 cells were purchased from ATCC.
[0038] See Table 1 for primer information.
[0039] Table 1 Primer Information
[0040] Primer name
Primer sequence (5'---3')
M-P1
CAATGACA GAATTC ATGAGCAAATGCCATAATTAC
EcoR I
M-H-P...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
