Supercharge Your Innovation With Domain-Expert AI Agents!

A construction method and application of the nkg2d fluorescent reporter system for testing the receptor signaling pathway of nk cell activation

A reporting system and signaling pathway technology, applied in the establishment and application of cell models, can solve problems such as NKG2D expression methods that have not yet been studied

Active Publication Date: 2019-06-18
CENT SOUTH UNIV
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the expression method of NKG2D on normal cells has not yet been studied

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A construction method and application of the nkg2d fluorescent reporter system for testing the receptor signaling pathway of nk cell activation
  • A construction method and application of the nkg2d fluorescent reporter system for testing the receptor signaling pathway of nk cell activation
  • A construction method and application of the nkg2d fluorescent reporter system for testing the receptor signaling pathway of nk cell activation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0034] Reagent source:

[0035] DMEM high-glucose medium and 1640 medium are commercial products, purchased from Hiclone Company; newborn bovine serum is a commercial product, purchased from Gibco Company; primers were synthesized by BGI; high-efficiency transfection reagent PolyJet was purchased from SignaGen Company; Labeled NKG2D monoclonal antibody and FITC-labeled human DAP12 monoclonal antibody were purchased from BD Company; recombinant soluble MICA and MICB proteins were prepared by our laboratory.

[0036] Strains, vectors, and cell sources:

[0037] Escherichia coli DH5α was purchased from Takara Company, plasmids pLXSN16E6E7 and pCL-Eco were purchased from Addgene, HEK293T cells, and 3A9 cells were purchased from ATCC.

[0038] See Table 1 for primer information.

[0039] Table 1 Primer information

[0040] Primer name

Primer sequence (5'---3')

Endonuclease

M-P1

CAATGACA GAATTC ATGAGCAAATGCCATAATTAC

EcoR I

M-H-P2

CAAA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a construction method and an application of an NK (natural killer) cell activation testing receptor signal path NKG2D fluorescence report system. A human NKG2D extracellular region gene sequence and mouse NKG2D transmembrane region and cytoplasmic region gene sequences are obtained by the aid of PCR (polymerase chain reaction) technology, the human and mouse NKG2D gene sequences are connected together by the aid of overlapping PCR technology, and the constructed human and mouse heterozygous NKG2D sequences are inserted into a pLXSN16E6E7 vector to form a vector pLXSN16E6E7-mhNKG2D. A human DAP12 gene sequence is constructed by the aid of the PCR technology and inserted into the pLXSN16E6E7 vector to form a vector pLXSN16E6E7-hDAP12. Plasmids of the two vectors and helper plasmids pCL-ECO of a retrovirus system are co-transfected with HEK293T cells to obtain virus particles containing reinfected mouse cells 3A9. Cell supernatants containing virus particles infect the cells 3A9, a cell line 12A9 steadily expressing mouse and human infusion NKG2D and human DAP12 is screened out by means of repeated flow sorting and re-culture, and downstream signals of NKG2D can be activated under the stimulus of human NKG2D ligand MICA / MICB, so that green fluorescence emitted by the cells can be detected by GFP (green fluorescent protein) expression.

Description

technical field [0001] The invention relates to an NK cell membrane receptor NKG2D fluorescent reporter system, in particular to a construction method of the reporter system and establishment and application of a cell model. Background technique [0002] NKG2D is an activating receptor of NK cells, which can be expressed in a variety of immune cells, such as CD8+αβT cells, γδT cells and NKT cells. It is not expressed in normal CD4+T cells, but can be expressed under the action of TNF-α and IL-15 induced expression. Ligands of NKG2D include the MHC class I chain-associated molecule family (MICA / B) and the human cytomegalovirus protein UL16-binding protein (ULBP) family. Among them, MICA / B is expressed on the surface of normal intestinal epithelium, and can be expressed on infected cells or tumor cells under stress induction, such as viral or bacterial infection, and malignant transformation. The expression of the up-regulated ligand can recognize with NKG2D activation recep...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/85C12N15/66C12N15/65
CPCC12N15/65C12N15/66C12N15/85C12N2800/107
Inventor 邹义洲罗伟光郭靖郭旭丽
Owner CENT SOUTH UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More