A construction method and application of the nkg2d fluorescent reporter system for testing the receptor signaling pathway of nk cell activation
A reporting system and signaling pathway technology, applied in the establishment and application of cell models, can solve problems such as NKG2D expression methods that have not yet been studied
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0034] Reagent source:
[0035] DMEM high-glucose medium and 1640 medium are commercial products, purchased from Hiclone Company; newborn bovine serum is a commercial product, purchased from Gibco Company; primers were synthesized by BGI; high-efficiency transfection reagent PolyJet was purchased from SignaGen Company; Labeled NKG2D monoclonal antibody and FITC-labeled human DAP12 monoclonal antibody were purchased from BD Company; recombinant soluble MICA and MICB proteins were prepared by our laboratory.
[0036] Strains, vectors, and cell sources:
[0037] Escherichia coli DH5α was purchased from Takara Company, plasmids pLXSN16E6E7 and pCL-Eco were purchased from Addgene, HEK293T cells, and 3A9 cells were purchased from ATCC.
[0038] See Table 1 for primer information.
[0039] Table 1 Primer information
[0040] Primer name
Primer sequence (5'---3')
M-P1
CAATGACA GAATTC ATGAGCAAATGCCATAATTAC
EcoR I
M-H-P2
CAAA...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



