Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Molecular marker bsa10 for early identification of muskmelon ms5 male sterility and its application

A molecular marker and male sterility technology, applied in the field of plant molecular genetic breeding research, can solve the problems of melon male sterility lag, etc., and achieve the effect of overcoming low breeding efficiency, simple operation method, and strong variation stability

Active Publication Date: 2019-07-16
HEILONGJIANG BAYI AGRICULTURAL UNIVERSITY
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For more than a decade, research on the male sterility of melons has lagged behind that of other crops, and melons ms-5 There is no relevant report on gene research

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker bsa10 for early identification of muskmelon ms5 male sterility and its application

Examples

Experimental program
Comparison scheme
Effect test

specific Embodiment approach 1

[0019] Embodiment 1: This embodiment provides a molecular marker BSA10 for early identification of ms5 type male sterility in muskmelon, and its primer sequence is:

[0020] BSA10F: AGTAGCAACTCTCGTGGCCTATTAG,

[0021] BSA10R: GCAAGACTCAAGATCAAGTGGCATAT.

[0022] The method for obtaining the above-mentioned molecular marker BSA10 is as follows:

[0023] 1. Construction of genetic population of melon

[0024] Using the muskmelon male sterile mutant thick-skinned muskmelon ms5 as the female parent, and the homozygous line HM-1 of the thin-skinned muskmelon in Heilongjiang Province, the F 1 , F 2 Group, BC 1 P 1 and BC 1 P 2 group. Plant 650 ms-5×HM-1F 2 , obtained sterile plants, obtained 502 fertile plants and 148 sterile plants, F 2 The segregation ratio of fertile plants to sterile plants was 3:1. Plant BC 1 P 1 Population 161 strains, BC 1 P 1 The fertile: sterile ratio in the population was 85:86, and the backcross population met the segregation ratio of 1:1 by...

specific Embodiment approach 2

[0030] Specific embodiment two: present embodiment provides a kind of method utilizing molecular marker method to detect the ms5 gene of muskmelon male sterility, concrete steps are as follows:

[0031] (1) Extract the DNA of the sample to be tested, and perform PCR amplification using the molecular marker BSA10. 10μL PCR reaction system: 30ng / μL DNA 2μL, BSA10 primer upstream and downstream 0.2μL, 10×PCR buffer 1μL, 2.5mM dNTp0.3μL, Taq enzyme 0.1μL, ddH 2 O 6.4 μL. The PCR amplification conditions were: 94°C pre-denaturation for 2 minutes, 94°C denaturation for 20 Sees, 68°C annealing for 1 min, 72°C extension for 30Sec, a total of 6 cycles, each cycle temperature decreased by 2°C; 94°C denaturation for 20 Sees, 58°C annealing for 1 min, 72°C extension 30Sec, a total of 6 cycles, each cycle temperature decreased by 1°C; 94°C denaturation 20See, 50°C annealing 30Sec, 72°C extension 30Sec, a total of 20 cycles, and finally 72°C extension 5min.

[0032] (2) The PCR reaction p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular marker BSA10 for early identification of melon sm5 type male sterile and application of molecular marker BSA10. The primer sequence of the molecular marker BSA10 is: BSA10F: AGTAGCAACTCTCGTGGCCTATTAG; and BSA10R: GCAAGACTCAAGATCAAGTGGCATAT. The above molecular marker BSA10R can be used for identifying the melon male sterile ms5 gene and melon molecular marker assistant breeding. According to the high throughput sequencing, the melon genome data can be obtained, and caps molecular mark related to the melon male sterile can be designed and developed. The molecular marker-assisted selection method can screen the melon male sterile plant on the seedling stage of melon, shorten the breeding period, improve the breeding efficiency, overcome the problem of low breeding efficiency due to the fact that melon male sterile plant can be distinguished only in the flowering period in the prior art and realize the technical effect that melon male sterile identification can be conducted on the seedling stage.

Description

technical field [0001] The invention belongs to the field of plant molecular genetic breeding research, and relates to a molecular marker for early identification of muskmelon ms5 type male sterility and its application. Background technique [0002] Melon (C ucumis melo L.) has obvious heterosis compared with other crops. Over the years, researchers and breeders at home and abroad have cultivated a large number of excellent first-generation melon hybrid seeds, creating huge economic benefits. However, at present, hybrid seed production still continues measures such as manual removal of female male flowers, artificial pollination, and bagging. The process is complicated, the workload is heavy, and the cost is high. It is easy to cause damage to flower organs, thereby causing a decline in yield. McCreight and Elmstrom (1984) pointed out that F 1 The cost of artificial seed production is 12-30 times of the cost of natural pollination. Male sterility is an important and stab...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12Q1/6858C12N15/11
CPCC12Q1/6858C12Q1/6895C12Q2600/13C12Q2600/156C12Q2521/301C12Q2531/113C12Q2565/125
Inventor 盛云燕魏金鹏纪鹏于高波曹阳矫士琦李德泽
Owner HEILONGJIANG BAYI AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com