Molecular marker bsa10 for early identification of muskmelon ms5 male sterility and its application
A molecular marker and male sterility technology, applied in the field of plant molecular genetic breeding research, can solve the problems of melon male sterility lag, etc., and achieve the effect of overcoming low breeding efficiency, simple operation method, and strong variation stability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
specific Embodiment approach 1
[0019] Embodiment 1: This embodiment provides a molecular marker BSA10 for early identification of ms5 type male sterility in muskmelon, and its primer sequence is:
[0020] BSA10F: AGTAGCAACTCTCGTGGCCTATTAG,
[0021] BSA10R: GCAAGACTCAAGATCAAGTGGCATAT.
[0022] The method for obtaining the above-mentioned molecular marker BSA10 is as follows:
[0023] 1. Construction of genetic population of melon
[0024] Using the muskmelon male sterile mutant thick-skinned muskmelon ms5 as the female parent, and the homozygous line HM-1 of the thin-skinned muskmelon in Heilongjiang Province, the F 1 , F 2 Group, BC 1 P 1 and BC 1 P 2 group. Plant 650 ms-5×HM-1F 2 , obtained sterile plants, obtained 502 fertile plants and 148 sterile plants, F 2 The segregation ratio of fertile plants to sterile plants was 3:1. Plant BC 1 P 1 Population 161 strains, BC 1 P 1 The fertile: sterile ratio in the population was 85:86, and the backcross population met the segregation ratio of 1:1 by...
specific Embodiment approach 2
[0030] Specific embodiment two: present embodiment provides a kind of method utilizing molecular marker method to detect the ms5 gene of muskmelon male sterility, concrete steps are as follows:
[0031] (1) Extract the DNA of the sample to be tested, and perform PCR amplification using the molecular marker BSA10. 10μL PCR reaction system: 30ng / μL DNA 2μL, BSA10 primer upstream and downstream 0.2μL, 10×PCR buffer 1μL, 2.5mM dNTp0.3μL, Taq enzyme 0.1μL, ddH 2 O 6.4 μL. The PCR amplification conditions were: 94°C pre-denaturation for 2 minutes, 94°C denaturation for 20 Sees, 68°C annealing for 1 min, 72°C extension for 30Sec, a total of 6 cycles, each cycle temperature decreased by 2°C; 94°C denaturation for 20 Sees, 58°C annealing for 1 min, 72°C extension 30Sec, a total of 6 cycles, each cycle temperature decreased by 1°C; 94°C denaturation 20See, 50°C annealing 30Sec, 72°C extension 30Sec, a total of 20 cycles, and finally 72°C extension 5min.
[0032] (2) The PCR reaction p...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com