Product
Patsnap Eureka
For R&D, Patsnap Eureka makes reading and utilizing patents & technical documents easy.
Patsnap Eureka AIR
Designed for self-driven R&D workflows. Generate viable solutions, solve complex R&D challenges, empower your innovation with AI.
Patsnap Eureka Materials
Designed for material experts only. Revolutionize your material R&D, from search, analyze, to developing new materials.
Feature
TechResearch
Generate reliable direction feasibility study reports for your R&D in just a few steps.
TechSeek
Discover and master advanced knowledge NOW. Basics, ideas, possibilities, all at once.
TechMind
As an expert in R&D Theories, TechMind can generates customized viable solutions instantly.
TechRisk
Analyze your overall solution with one click, know your potential R&D risks in advance.
TechMonitor
Get weekly tech updates, stay abreast of the latest tech innovations and key insights.
Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
36results about How to "Shorten the number of years" patented technology
Efficacy Topic
Property
Owner
Technical Advancement
Application Domain
Technology Topic
Technology Field Word
Patent Country/Region
Patent Type
Patent Status
Application Year
Inventor
Method for massively planting apocynum venetum on saline-alkali desert lands
ActiveCN101965777AOvercoming sowing seedlingsFast growthPlantingCultivating equipmentsApocynum venetumGreenhouse
The invention relates to a method for massively planting apocynum venetum on saline-alkali desert lands. The method is implemented by the steps of seed screening, nutrition cup preparation, room-temperature facility arrangement, seeding in time, seeding amount control, management during seedling time, nursery garden transplanting, nursery garden field management and large-field transplanting. In the method, massive and productive apocynum venetum planting experiments are carried out under specific weather conditions in the Altay region of Xinjiang, and the experiments prove that when the method is used, the survival rate of the apocynum venetum large-field strains planted on the gobi desert lands reaches 95.8 to 96.4 percent, a service life is shortened, and an application prospect is wide. Particularly, the seedling plants for the gobi desert lands can be cultivated in one year, so that the shortcoming that the conventional large field or nursery garden seedlings raised by direct seeding are transplanted to the gobi desert lands after 2 to 3 years generally is overcome and the massive planting and mechanical field management are realized.
Owner:XINJIANG ALTAY PREFECTURE GAUBAO KENDER CO LTD
Wine cellar-storage method
ActiveCN104164349AShorten the number of yearsAccelerated agingAlcoholic beverage preparationWine cellarSludge
The invention discloses a wine cellar-storage method which comprises the following steps: blending and seasoning original pulp wine, adding into a pottery wine jar, covering a jar cap, and tying the jar cap with kraft; covering vinasse on the external surface of the wine jar, storing in a cellar for 4-6 days, and taking out the wine jar; uniformly mixing fine soil, vinasse and water in a weight ratio of (10-20):(8-12):(12-16) to obtain vinasse sludge; blending and seasoning the wine, adding into a red porcelain wine jar, immediately covering a jar cap, covering the vinasse sludge around the wine jar, burying the wine jar in the soil, and storing in the cellar for 2-3 years to obtain the finished product. The method has the advantages of simple technique and excellent cellar-storage effect, is easy to implement, greatly shortens the wine production cycle and lowers the production cost.
Owner:GUIZHOU MAOTAI TOWN GUOWEI WINE GRP
High-yield cultivation method for honeysuckles in low mountains and hills
InactiveCN103168602AMany differentiationsIncrease productionFertilising methodsHorticulture methodsSocial benefitsChlorogenic acid
The invention relates to a high-yield cultivation method for honeysuckles in low mountains and hills. The method includes the key technical steps such as variety selection, raising of seedlings by cutting, digging of planting holes, base fertilizer application and planting, covering of mulching films, pruning, integrated control of plant diseases and insect pests and topdressing. The method is characterized in that growth and development of plants of the honeysuckles are obviously promoted, the time limit ahead of the high-yield period is shortened, the yield of the honeysuckles is improved, and the quality of the honeysuckles is guaranteed. Compared with an ordinary planting method, the high-yield cultivation method enables the yield in the first year after transplant to be promoted by 56.7%, the yield in the second year after the transplant is promoted by 87.3%, and the yield in the third year after the transplant is promoted by 116.6%. However, no obvious changes happen on the content of chlorogenic acid of the honeysuckles and contents of galuteolin of the honeysuckles, the content of the chlorogenic acid of the honeysuckles and the content of the galuteolin of the honeysuckles all meet the standard provisions of <pharmacopoeia of the people's republic of China> (2010 version), and social benefits, economic benefits and ecological benefits are remarkable.
Owner:张永清 +3
Method for rapidly obtaining pure line of hybrid wheat
InactiveCN101946629AEasy to optimizeInduction frequency is highAspharagus cultivationPlant tissue cultureBiotechnologySporeling
The invention relates to a method for rapidly obtaining a pure line of hybrid wheat, comprising the following steps: (1) preparing a hybridized combination; (2) planting a hybrid material; (3) determining an appropriate ear fetching period; (4) pre-treating anther; (5) dissociating and purifying microspores: (6) adjusting the density of the microspores; (7) forming microspore embryos by induction; (8) forming regenerated plants by differentiation culture; (9) allowing regenerated seedlings to pass the summer at low temperature; (10) culturing the strong seedlings; (11) hardening the seedlings; (12) transplanting the seedlings; (13) managing the transplanted seedlings; and (14) harvesting after the seedlings become mature. In the method, a test material is directly planted in a field and the microspores are dissociated from the anther for culture to eliminate the disturbance of an anther wall, thus being beneficial to optimization of various culture factors, improving the induction frequency of the microspore embryos, overcoming limitation on a genotype, promoting more hybrid combined materials to obtain the regenerated plants, providing more abundant base materials for variety breeding, and playing an important role in enhancing the breeding efficiency of a haploid.
Owner:甘肃省农业科学院生物技术研究所
Method for polymerizing and screening anti-soybean mosaic virus genes for soybean
InactiveCN102808021AReduce blindnessShorten the number of yearsMicrobiological testing/measurementResistant genesF1 generation
The invention discloses a method for polymerizing and screening anti-soybean mosaic virus genes for soybean. The method is characterized by comprising the following steps of: identifying three resistant germplasms, i.e., Qihuang No.1, Kefeng No.1 and big white grain carrying different resistant genes respectively, and a variety with good economical character, i.e., Nannong 1138-2; hybridizing the Qihuang No.1, the Kefeng No.1 and the big white grain with the Nannong 1138-2 with the conventional method to obtain F1 generations; hybridizing two F1 in a compound way; planting a compound hybridized F1 generation; inbreeding to harvest an F2 generation seed; and screening a soybean plant polymerized by using three anti-soybean mosaic virus genes by continuously using a determined molecular marker which is tightly linked with the resistant gene from the generations F2 to F5. According to the method, three resistant genes can be selected simultaneously, the blindness of disease-resistant breeding selection is reduced, and a descendant material polymerized from a plurality of homozygous resistant genes can be selected quickly, so that the disease-resistant breeding period is shortened, and the disease-resistant breeding efficiency is increased.
Owner:NANJING AGRICULTURAL UNIVERSITY
Method for breeding rice vairety with polymerized low-glutelin and rice stripe-resistance
InactiveCN101347094AGood qualityShorten the number of yearsMicrobiological testing/measurementPlant genotype modificationFingerprintAgricultural science
The invention discloses a breeding method of a rice species combining the properties of low glutelin and rice stripe disease resistance, which pertains to the field of rice breeding. W3660 is taken as a female parent and Zhendao 88 is taken as a male parent for hybridization; and since F2 generation, a single plant with a main ear having 12 grains, the holoprotein SDS-PAGE protein band pattern of which is in line with W3660 holoprotein band pattern, is selected for planting; WW1 and R15 marks are used for assisting the selection; by combining the field inoculation and manual inoculation certification of the plants with rice stripe disease resistance, a plant strain which has rice stripe disease resistance and is characterized in that the SSR fingerprint has a low glutelin characteristic band 237bp marked by WW1 and a rice stripe disease resistance characteristic band 363bp marked by R15, and the growth duration, plant height, and shape and characteristics of the plant leaves are identical with that of the Zhendao 88 is selected and named as W1721. After determination, the new rice variety W1721 has low glutelin content and less than 4% of the absorbable protein (including albumin-globulin and glutelin) content and has rice stripe disease resistance.
Owner:NANJING AGRICULTURAL UNIVERSITY
Sprout grafting method for fructus schizandrae
InactiveCN101194570AReduce the cost of graftingShorten the number of yearsHorticultureHypocotylGraft survival
The invention relates to a bud seedling grafting method for schisandra fruit, which belongs to the breeding technique in the crop cultivation science field. The grafting method for schisandra fruit takes seeds of schisandra fruit after germinating whose cotyledons stretch before true leaves stretch as a rootstock, and takes green branches of schisandra fruit as grafts and graft to grow a new plant. The grafts are semi-lignified new shoots or lateral shoots or young shoots which are tissue-cultivated. The grafting is that grafts are connected in a slot on a lower hypocotyl of the rootstock, which guarantees that grated breed seedlings can be cultivated on the year that a rootstock is sowed, reduces grafting cost, shortens age limit of seedling breed and improves grafting efficiency evidently, and the grafting survival rate reaches about 95%. The invention can be applied to grafting seedling production of schisandra fruit, and can promote fructifying in advance, and avoids generation of underground traverse stems.
Owner:艾军
Multi-site molecular marker assistant selection method capable of combining with conventional breeding whole process of wheat
ActiveCN104109713ATo achieve a real bondImprove selection accuracyMicrobiological testing/measurementPlant genotype modificationMulti siteGenotype
The invention relates to a multi-site molecular marker assistant selection method capable of combining with a conventional breeding whole process of wheat. The invention discloses a concrete enforcement method for performing the molecular marker assistant selection technology in the conventional breeding whole process for the first time, the method uses the prerequisite that a molecular marker assistant breeding selection colony is created through a molecule breeding element, the whole breeding process selects genotype through molecular marker, and the method overcomes the disadvantage that conventional breeding selects the genotype according to phenotype.
Owner:SHANDONG AGRICULTURAL UNIVERSITY
Method for early screening of fine varieties of nobile-types
InactiveCN103461116AShorten the number of yearsImprove the efficiency of variety screeningPlant genotype modificationScreening methodSeedling
The invention discloses a method for early screening of fine varieties of nobile-types. The method comprises the following steps of a, measuring plant heights and leaf lengths of annual cutting seedlings; b, calculating the quality comprehensive score of a nobile-types flower by substituting the average values of the plant heights and the leaf lengths into a regression equation y=0.511*1 (plant height)+0.845*2 (leaf length)-7.247; and c, predicating the quality of the nobile-types flower according to the quality comprehensive score of the nobile-types flower and variety grading reference criteria. The method provided by the invention improves the variety screening efficiency, shortens the screening cycle, and saves the production cost.
Owner:BEIJING FORESTRY UNIVERSITY +1
Screening and cultivating method of mountainous snow peach variety
The invention discloses a method for screening and cultivating mountain snow peach varieties. The method includes the following steps: firstly, the selected stock is carefully cultivated and branched; Select the best late-maturing peach tree varieties. The selected rootstock seedlings have been cultivated to increase the number of lateral branches on the rootstock, avoiding the fact that one rootstock can only be grafted with one newborn scion in seconds, so that multiple newborn branches of late-growing peaches can be grafted at one time. The scope of selective breeding is greatly improved and the efficiency is improved.
Owner:六安市叶集区成芳林果种植家庭农场
Method for creating novel germ plasm of translocation line through anther culture of intergeneric hybrids between wheat and Leymus multicaulis
InactiveCN102106255AEnhanced tillering abilityComprehensive agronomic traits are goodHorticulture methodsPlant tissue cultureGerm plasmGermplasm
The invention relates to a method for creating a new germ plasm of a translocation line through anther culture of intergeneric hybrids between wheat and Leymus multicaulis. The method comprises the steps as follows: firstly, selecting basis material from filial generation of wheat and Leymus multicaulis; secondly, performing anther culture to filial generation of the basis material and a 'bridge variety'; thirdly, transplanting seedlings of anther culture plants; fourthly, accelerating generation advancement of natural doubling plants in a green house, and doubling haplobiont artificially; and fifthly, reaping pure seeds of the later generations of the anther culture plants, and planting and identifying the pure seeds to obtain the translocation line. In the invention, 'Shi 4185' and 'Jimai 38', which are taken as the female parent, serve as 'bridge variety' to be hybridized with the basis material; and through the optimization of culture medium and culture condition, the highest callus induction of callus reaches 45.4%, the differentiation rate is 92.7%, wherein the differentiation rate of green seedlings is 40%, the final yield of green seedlings is 26.3%, and the survival rate of transplantation is 94%. Under the premise of ensuring that effective selection population is obtained, excellent economical characters of the bridge variety is induced.
Owner:HEBEI UNIVERSITY OF SCIENCE AND TECHNOLOGY
Cultivating method of arbor-type malvaviscus arboreus landscape tree
ActiveCN105724069AOvercoming the Weakness of DrynessEnhance landscape valueBud removersGraftingRootstockCladodes
The invention discloses a cultivating method of an arbor-type malvaviscus arboreus landscape tree. The method comprises the steps that hibiscus tiliaceus or H.tilliaceus 'tricolor' serves as a rootstock for grafting, a semi-lignified branch of malvaviscus arboreus is cut short and serves as a scion; in the grafting process, a split opening of the rootstock is made to be aligned with one side of wedged edges of the scion, the upper portion of the wedged part of the scion is reserved by 0.1-0.3 cm to be exposed outside, and the scion is bundled tightly through thin film; after grafting is completed, rootstock bud removing, thin film needling, scion pruning and positive management are conducted in time. According to the cultivating method of the arbor-type malvaviscus arboreus landscape tree, the advantages of the malvaviscus arboreus and hibiscus tiliaceus tree species are integrated into a whole, and the ornamental value, landscape value and economic value of the malvaviscus arboreus are significantly improved; the time for cultivating arbor-type malvaviscus arboreus is shortened, and the defect that the malvaviscus arboreus is poor in dryness is overcome.
Owner:XISHUANGBANNA TROPICAL BOTANICAL GARDEN CHINESE ACAD OF SCI
Planting method of white paeony roots
InactiveCN104838847APlanting method is simpleIncrease productionHorticultureEconomic benefitsPest control
The invention relates to a planting method of white paeony roots. The planting method comprises the steps of base fertilizer application, planting, management of a growing period, pest control and prevention and harvesting and processing. At the growing period, when the white paeony roots are 10-15cm high, branches which are 1-2.5cm far away from the upper part of the soil are cut to form wedged gaps, the sectional area of the gaps on one wider ends of the radial directions of the branches are 1 / 3 greater than the cross section area of the branches at the place, the gaps are larger in lower part and smaller in upper part, and the gaps are coated by a mixture of 2-5g of quick lime, 1-2g of urea and 3-6g of plant ash and are covered by cloths, and then 1500 times of compound sodium nitrophenolate solution is sprayed to the branches of the white paeony roots. The planting method of white paeony roots is simple and feasible, the yield of the white paeony roots can be improved by 32% by processing fertilizers in the growing process, and the content of 2-year old paeoniflorin of the white paeony roots can reach up to a medicinal standard, the age limit between the planting and harvesting for medicine can be greatly reduced, the economic benefit of the white paeony roots can be improved, and the paeoniflorin content in the white paeony roots can be improved by 15%.
Owner:ZONGYANG COUNTY BAIYUN ECOLOGICAL GARDEN
Early screening method for good varieties of bundle plant type nobile-type dendrobium
ActiveCN104542025AShorten the number of yearsImprove the efficiency of variety screeningHorticulture methodsSeedlingDendrobium
The invention discloses an early screening method for good varieties of bundle plant type nobile-type dendrobium. The method comprises the following steps: a, determining the number of leaves and the number of segments of one-year-old seedlings in a leaf termination period; b, respectively substituting the mean values of the number of leaves and the number of segments into corresponding linear equations y1=2.061x1(the number of leaves)-8.060, and y2=1.534x2 (the number of segments)-7.654; calculating the comprehensive score of the quality of nobile-type dendrobium flowering; c, predicting the nobile-type dendrobium flowering quality according to the comprehensive score of the quality of nobile-type dendrobium products and a variety grade dividing reference standard. According to the early screening method for good varieties of the bundle plant type nobile-type dendrobium disclosed by the invention, the variety screening efficiency is improved; the screening cycle is shortened; the production cost is reduced.
Owner:BEIJING FORESTRY UNIVERSITY
Radix in-vitro propagation technology taking buds of fruited taro-fragrance wax gourds as explants
InactiveCN109463284AIncrease production capacityHigh purityPlant tissue cultureHorticulture methodsGourdBud
The invention relates to the technology of plant tissue culture, in particular to a radix in-vitro propagation technology taking buds of fruited taro-fragrance wax gourds as explants. The buds of fruited taro-fragrance wax gourds are taken as explants, after sterilization and inoculation, cluster buds are cultured on a bud inducing medium, an enrichment medium is inoculated with induced cluster buds for enrichment culture of the cluster buds, enriched buds are obtained and transferred to a rooting medium for root induction when growing to 2-3 cm, complete plants are formed, and expanding propagation seedlings are obtained after seedlings are subjected to exercise, acclimatization and successful transplantation.
Owner:广州市农业科学研究院
Substrate culture method for reducing continuous cropping obstacle of rehmannia
InactiveCN102356747BSolve the problem that the land cannot be replanted and must be changed every yearShorten the number of yearsCultivating equipmentsSoilless cultivationContinuous croppingFungicide
Owner:HENAN AGRICULTURAL UNIVERSITY
Selective breeding method of special rice variety for nephrosis and diabetes patients
InactiveCN1225161CGood qualityShorten the number of yearsPlant genotype modificationProtein contentFingerprint
The present invention is development of special rice variety for nephrosis and diabetes patients and belongs to the development of new rice variety. Through the analysis of rice in storage protein content, protein coponents, SDS-PAGE, SSR mark, etc., the molecular mark selection, the measurement of SDS-PAGE, protein content, etc., new rice variety W3660 with water soluble protein content less than 4% is developed.
Owner:NANJING AGRICULTURAL UNIVERSITY
Method for rapidly obtaining pure line of hybrid wheat
InactiveCN101946629BEasy to optimizeInduction frequency is highAspharagus cultivationHorticulture methodsBiotechnologySporeling
The invention relates to a method for rapidly obtaining a pure line of hybrid wheat, comprising the following steps: (1) preparing a hybridized combination; (2) planting a hybrid material; (3) determining an appropriate ear fetching period; (4) pre-treating anther; (5) dissociating and purifying microspores: (6) adjusting the density of the microspores; (7) forming microspore embryos by induction; (8) forming regenerated plants by differentiation culture; (9) allowing regenerated seedlings to pass the summer at low temperature; (10) culturing the strong seedlings; (11) hardening the seedlings; (12) transplanting the seedlings; (13) managing the transplanted seedlings; and (14) harvesting after the seedlings become mature. In the method, a test material is directly planted in a field and the microspores are dissociated from the anther for culture to eliminate the disturbance of an anther wall, thus being beneficial to optimization of various culture factors, improving the induction frequency of the microspore embryos, overcoming limitation on a genotype, promoting more hybrid combined materials to obtain the regenerated plants, providing more abundant base materials for variety breeding, and playing an important role in enhancing the breeding efficiency of a haploid.
Owner:甘肃省农业科学院生物技术研究所
Soil preparation for old apple orchard and preparation method of soil preparation
InactiveCN107099297AShorten the number of yearsIncrease annual outputPlant growth regulatorsBiocideFruit treePropylene glycol
The invention discloses a soil preparation for an old apple orchard and a preparation method of the soil preparation. The preparation comprises the following components by weight: 85-100 parts of poloxamer, 120-160 parts of triethanolamine, 90-110 parts of 1,3-propylene glycol, and 1000 parts of water. The preparation integrates various elements, the age limit for replanting a new fruit tree in the old orchard is effectively shortened, the apple yield is greatly improved, and the defects of the prior art are made up.
Owner:邹祥茂
Molecular marker bsa10 for early identification of muskmelon ms5 male sterility and its application
ActiveCN105925708BWide distributionShorten the number of yearsMicrobiological testing/measurementDNA/RNA fragmentationAgricultural scienceGenome
Owner:HEILONGJIANG BAYI AGRICULTURAL UNIVERSITY
Method for massively planting apocynum venetum on saline-alkali desert lands
ActiveCN101965777BOvercoming sowing seedlingsFast growthPlantingCultivating equipmentsApocynum venetumGreenhouse
The invention relates to a method for massively planting apocynum venetum on saline-alkali desert lands. The method is implemented by the steps of seed screening, nutrition cup preparation, room-temperature facility arrangement, seeding in time, seeding amount control, management during seedling time, nursery garden transplanting, nursery garden field management and large-field transplanting. In the method, massive and productive apocynum venetum planting experiments are carried out under specific weather conditions in the Altay region of Xinjiang, and the experiments prove that when the method is used, the survival rate of the apocynum venetum large-field strains planted on the gobi desert lands reaches 95.8 to 96.4 percent, a service life is shortened, and an application prospect is wide. Particularly, the seedling plants for the gobi desert lands can be cultivated in one year, so that the shortcoming that the conventional large field or nursery garden seedlings raised by direct seeding are transplanted to the gobi desert lands after 2 to 3 years generally is overcome and the massive planting and mechanical field management are realized.
Owner:XINJIANG ALTAY PREFECTURE GAUBAO KENDER CO LTD
Molecular marker bsa3-2 closely linked to ms5 gene of muskmelon male sterility and its application
ActiveCN106048025BWide distributionShorten the number of yearsMicrobiological testing/measurementDNA/RNA fragmentationAgricultural scienceGenome
The invention discloses a molecular marker BSA3-2 closely linked with a muskmelon male sterility ms5 gene and application of the molecular marker BSA3-2. Primer sequences of the molecular marker BSA3-2 are BSA3-2F:TGCTTATGTGAGTGAGTCTGCTGAC, and BSA3-2R:CAATGGTGTGGTGGAAGTTCTGGAA. The molecular marker BSA3-2 can be used for identification of the muskmelon male sterility ms5 gene and molecular marker-assisted breeding of muskmelons. According to the molecular marker BSA3-2 and the application thereof disclosed by the invention, a genome data of the muskmelons are obtained according to a high throughput sequencing technology; a caps molecular marker related to muskmelon male sterility is designed and developed; by using the method of molecular marker-assisted selection breeding, the screening of muskmelon male sterility plants can be performed at a seedling stage of the muskmelons, so that the age limit of breeding is shortened, the breeding efficiency is improved, and the problem of low breeding efficiency due to the fact that the muskmelon male sterility plants can be only distinguished at a flowering stage in the prior art is solved.
Owner:HEILONGJIANG BAYI AGRICULTURAL UNIVERSITY
Breeding process of transgenic bollworm resisting cotton hybrid
InactiveCN1126446CIncrease productionImprove breeding efficiencyPlant genotype modificationHigh resistanceCotton bollworm
The invention discloses a method for breeding transgenic cotton bollworm-resistant cotton hybrids, which is specially used for the breeding of cotton bollworm-resistant cotton hybrids transgenic with Bt+CpTI bivalent genes. The insect resistance identification and breeding of the transgenic insect-resistant cotton "SGK321" were carried out, and the insect-resistant homozygous (100%) transgenic insect-resistant cotton "SGK321'" with lint yield increased by 9.5% compared with the raw material was obtained. The insect-resistant hybrid "Nankang 7" was bred with "SGK321'" as the male parent and "Sumian 12" as the female parent. The hybrid has high yield (90-150 kg of lint per mu), high resistance to cotton bollworm and can restrain possible resistance of cotton bollworm to cotton.
Owner:NANJING AGRICULTURAL UNIVERSITY
Preparation for shortening years of replanting new apple trees in old apple orchard and preparation method of preparation
InactiveCN107118776AShorten the number of yearsIncrease annual outputAgriculture tools and machinesOrganic fertilisersTriethanolamineOrchard
The invention discloses a preparation for shortening years of replanting new apple trees in an old apple orchard and a preparation method of the preparation. The preparation is prepared from the following components in parts by weight: 85 to 100 parts of poloxamer, 120 to 160 parts of triethanolamine, 90 to 110 parts of 1,3-propanediol and 1000 parts of water. The preparation disclosed by the invention has the advantages that various elements are integrated, the years of replanting new fruit trees in the old orchard are effectively shortened, and the yield of apples is greatly increased, thereby making up the defects of the prior art.
Owner:邹祥茂
Rapid containerization cultivation method for big trees for engineering
PendingCN114128614AImprove growing conditionsImprove survival rateGrowth substratesCulture mediaAgricultural landForest industry
According to the technical scheme, the rapid containerization cultivation method for the big tree for engineering is provided, and the cultivation process comprises the following steps that (1) a soilless culture substrate is poured into a specially-processed planting bag to the 1 / 3-3 / 4 position of the planting bag; (2) transplanting the selected saplings into planting bags with corresponding specifications according to the cultivation years of the big trees for different projects, adding a soilless culture substrate, thoroughly watering, paving a piece of ground cloth around a trunk, and fixing by ground nails; (3) 20-30 days after containerization management, burying young trees with good growth vigor and the planting bags into tree pits dug in advance, tamping, burying bag openings and bag lugs into soil, and exposing ground cloth; (4) field cultivation maintenance management, timely fertilizer supplementation, and supporting and fixing in advance in windy weather; and (5) during outplanting, digging soil around the planting bags, shoveling fibrous roots emerging from the planting bags, fixing bag lugs and trunks, and hoisting and loading. The method is simple in processing, the big tree cultivation time is obviously shorter than that of a traditional containerization production mode, the cost can be effectively controlled, the survival rate of big tree transplanting is increased, meanwhile, a soil layer is protected, and the use contradiction between agricultural land and forestry land is relieved.
Owner:HANGZHOU LANDSCAPING
A kind of early screening method for fine varieties of spring dendrobium
ActiveCN104542025BShorten the number of yearsImprove the efficiency of variety screeningHorticulture methodsScreening methodBiology
The invention discloses an early screening method for good varieties of bundle plant type nobile-type dendrobium. The method comprises the following steps: a, determining the number of leaves and the number of segments of one-year-old seedlings in a leaf termination period; b, respectively substituting the mean values of the number of leaves and the number of segments into corresponding linear equations y1=2.061x1(the number of leaves)-8.060, and y2=1.534x2 (the number of segments)-7.654; calculating the comprehensive score of the quality of nobile-type dendrobium flowering; c, predicting the nobile-type dendrobium flowering quality according to the comprehensive score of the quality of nobile-type dendrobium products and a variety grade dividing reference standard. According to the early screening method for good varieties of the bundle plant type nobile-type dendrobium disclosed by the invention, the variety screening efficiency is improved; the screening cycle is shortened; the production cost is reduced.
Owner:BEIJING FORESTRY UNIVERSITY
A kind of cultivation method of intercropping alfalfa and wheat under apricot and plum forest in oasis-desert transition zone
ActiveCN111713354BSave seedsImprove germination rateGraftingHops/wine cultivationEdaphicPest control
The invention relates to a cultivation method for intercropping alfalfa and wheat under an apricot and plum forest in an oasis-desert transition zone. Cultivation methods include: soil preparation, apricot and plum gardening, alfalfa and wheat sowing field water and fertilizer management, alfalfa and wheat harvesting, alfalfa pest control. The cultivation method can prevent wind and fix sand, improve soil nutrition, and increase soil water retention capacity, thereby improving the planting environment, increasing the emergence rate of direct-seeded peaches, and the grafting survival rate of apricots and plums in the later stage, and can shorten the period of fruit-bearing of apricots and plums to see benefits by 2 In addition, it can also improve the utilization rate of cultivated land. While harvesting apricots and plums in one year, you can also harvest three seasons of alfalfa, and the yield is about 15% higher than that of growing alfalfa alone. Provide a large amount of forage for cattle and sheep in the area to reduce the ecological pressure on the grassland. The economic benefit and ecological benefit are remarkable, and it has broad application prospects.
Owner:新疆农业科学院综合试验场
A kind of cultivating method of arbor type Platanus landscape tree
ActiveCN105724069BOvercoming the Weakness of DrynessEnhance landscape valueBud removersGraftingRootstockLandscape value
The invention discloses a cultivating method of an arbor-type malvaviscus arboreus landscape tree. The method comprises the steps that hibiscus tiliaceus or H.tilliaceus 'tricolor' serves as a rootstock for grafting, a semi-lignified branch of malvaviscus arboreus is cut short and serves as a scion; in the grafting process, a split opening of the rootstock is made to be aligned with one side of wedged edges of the scion, the upper portion of the wedged part of the scion is reserved by 0.1-0.3 cm to be exposed outside, and the scion is bundled tightly through thin film; after grafting is completed, rootstock bud removing, thin film needling, scion pruning and positive management are conducted in time. According to the cultivating method of the arbor-type malvaviscus arboreus landscape tree, the advantages of the malvaviscus arboreus and hibiscus tiliaceus tree species are integrated into a whole, and the ornamental value, landscape value and economic value of the malvaviscus arboreus are significantly improved; the time for cultivating arbor-type malvaviscus arboreus is shortened, and the defect that the malvaviscus arboreus is poor in dryness is overcome.
Owner:XISHUANGBANNA TROPICAL BOTANICAL GARDEN CHINESE ACAD OF SCI
A method for quickly obtaining old seedlings of primula moss
ActiveCN111280038BEasy to shapeChangeable shapeCultivating equipmentsHorticulture methodsPlant cultivationSeedling
Owner:BEIJING FORESTRY UNIVERSITY
Preparation for rapidly replanting new fruit trees in old apple orchard and preparation method thereof
InactiveCN107022356AShorten the number of yearsIncrease annual outputAgriculture tools and machinesOrganic fertilisersFruit treePropylene glycol
The invention discloses a preparation for rapidly replanting new fruit trees in an old apple orchard and a preparation method thereof. The preparation is prepared from the following components in parts by weight: 85 to 100 parts of poloxamer, 120 to 160 parts of triethanolamine, 90 to 110 parts of 1,3-propylene glycol and 1000 parts of water. The preparation disclosed by the invention integrates various elements, the term of replanting the new fruit trees in the old orchard is effectively shortened and the yield of apples is greatly improved, so that the disadvantages in the prior art are overcome.
Owner:邹祥茂
Who we serve
- R&D Engineer
- R&D Manager
- IP Professional
Why Patsnap Eureka
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com