Molecular marker bsa3-2 closely linked to ms5 gene of muskmelon male sterility and its application
A male sterility gene and molecular marker technology, applied in the field of plant molecular genetics and breeding research, can solve the problems of lagging male sterility in melon, and achieve the effects of improving breeding efficiency, wide distribution and strong variation stability.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
specific Embodiment approach 1
[0019] Specific embodiment one: this embodiment provides a kind of molecular marker BSA3-2 closely linked with the muskmelon male sterility ms5 gene, and its primer sequence is:
[0020] BSA3-2F: TGCTTATGTGAGTGAGTCTGCTGAC,
[0021]BSA3-2R: CAATGGTGTGGTGGAAGTTCTGGAA.
[0022] The method for obtaining the above-mentioned molecular marker BSA3-2 is as follows:
[0023] 1. Construction of genetic population of melon
[0024] Using the muskmelon male sterile mutant thick-skinned muskmelon ms5 as the female parent, and the homozygous line HM-1 of the thin-skinned muskmelon in Heilongjiang Province, the F 1 , F 2 Group, BC 1 P 1 and BC 1 P 2 group. Plant 650 ms-5×HM-1F 2 , obtained sterile plants, obtained 502 fertile plants and 148 sterile plants, F 2 The segregation ratio of fertile plants to sterile plants was 3:1. Plant BC 1 P 1 Population 161 strains, BC 1 P 1 Fertility in the population: 85:86 infertility, the backcross population conforms to 1:1 segregation rat...
specific Embodiment approach 2
[0030] Specific embodiment two: present embodiment provides a kind of method utilizing molecular marker method to detect the ms5 gene of muskmelon male sterility, concrete steps are as follows:
[0031] (1) Extract the DNA of the sample to be tested, and perform PCR amplification using the molecular marker BSA3-2. 10μL PCR reaction system: 30ng / μL DNA 2μL, BSA3-2 primer upstream and downstream 0.2μL, 10×PCR buffer 1μL, 2.5mM dNTp0.3μL, Taq enzyme 0.1μL, ddH 2 O 6.4 μL. PCR amplification conditions were: 94°C pre-denaturation for 2 min, 94°C denaturation for 20 See, 68°C annealing for 1 min, 72°C extension for 30 sec, a total of 6 cycles, each cycle temperature decreased by 2°C; 94°C denaturation for 20 See, 58°C annealing for 1 min , 72°C extension 30Sec, a total of 6 cycles, each cycle temperature decreased by 1°C; 94°C denaturation 20See, 50°C annealing 30Sec, 72°C extension 30Sec, a total of 20 cycles, and finally 72°C extension 5min.
[0032] (2) The PCR reaction product...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
