Supercharge Your Innovation With Domain-Expert AI Agents!

Molecular marker bsa3-2 closely linked to ms5 gene of muskmelon male sterility and its application

A male sterility gene and molecular marker technology, applied in the field of plant molecular genetics and breeding research, can solve the problems of lagging male sterility in melon, and achieve the effects of improving breeding efficiency, wide distribution and strong variation stability.

Active Publication Date: 2019-06-28
HEILONGJIANG BAYI AGRICULTURAL UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For more than a decade, research on the male sterility of melons has lagged behind that of other crops, and melons ms-5 There is no relevant report on gene research

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker bsa3-2 closely linked to ms5 gene of muskmelon male sterility and its application

Examples

Experimental program
Comparison scheme
Effect test

specific Embodiment approach 1

[0019] Specific embodiment one: this embodiment provides a kind of molecular marker BSA3-2 closely linked with the muskmelon male sterility ms5 gene, and its primer sequence is:

[0020] BSA3-2F: TGCTTATGTGAGTGAGTCTGCTGAC,

[0021]BSA3-2R: CAATGGTGTGGTGGAAGTTCTGGAA.

[0022] The method for obtaining the above-mentioned molecular marker BSA3-2 is as follows:

[0023] 1. Construction of genetic population of melon

[0024] Using the muskmelon male sterile mutant thick-skinned muskmelon ms5 as the female parent, and the homozygous line HM-1 of the thin-skinned muskmelon in Heilongjiang Province, the F 1 , F 2 Group, BC 1 P 1 and BC 1 P 2 group. Plant 650 ms-5×HM-1F 2 , obtained sterile plants, obtained 502 fertile plants and 148 sterile plants, F 2 The segregation ratio of fertile plants to sterile plants was 3:1. Plant BC 1 P 1 Population 161 strains, BC 1 P 1 Fertility in the population: 85:86 infertility, the backcross population conforms to 1:1 segregation rat...

specific Embodiment approach 2

[0030] Specific embodiment two: present embodiment provides a kind of method utilizing molecular marker method to detect the ms5 gene of muskmelon male sterility, concrete steps are as follows:

[0031] (1) Extract the DNA of the sample to be tested, and perform PCR amplification using the molecular marker BSA3-2. 10μL PCR reaction system: 30ng / μL DNA 2μL, BSA3-2 primer upstream and downstream 0.2μL, 10×PCR buffer 1μL, 2.5mM dNTp0.3μL, Taq enzyme 0.1μL, ddH 2 O 6.4 μL. PCR amplification conditions were: 94°C pre-denaturation for 2 min, 94°C denaturation for 20 See, 68°C annealing for 1 min, 72°C extension for 30 sec, a total of 6 cycles, each cycle temperature decreased by 2°C; 94°C denaturation for 20 See, 58°C annealing for 1 min , 72°C extension 30Sec, a total of 6 cycles, each cycle temperature decreased by 1°C; 94°C denaturation 20See, 50°C annealing 30Sec, 72°C extension 30Sec, a total of 20 cycles, and finally 72°C extension 5min.

[0032] (2) The PCR reaction product...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular marker BSA3-2 closely linked with a muskmelon male sterility ms5 gene and application of the molecular marker BSA3-2. Primer sequences of the molecular marker BSA3-2 are BSA3-2F:TGCTTATGTGAGTGAGTCTGCTGAC, and BSA3-2R:CAATGGTGTGGTGGAAGTTCTGGAA. The molecular marker BSA3-2 can be used for identification of the muskmelon male sterility ms5 gene and molecular marker-assisted breeding of muskmelons. According to the molecular marker BSA3-2 and the application thereof disclosed by the invention, a genome data of the muskmelons are obtained according to a high throughput sequencing technology; a caps molecular marker related to muskmelon male sterility is designed and developed; by using the method of molecular marker-assisted selection breeding, the screening of muskmelon male sterility plants can be performed at a seedling stage of the muskmelons, so that the age limit of breeding is shortened, the breeding efficiency is improved, and the problem of low breeding efficiency due to the fact that the muskmelon male sterility plants can be only distinguished at a flowering stage in the prior art is solved.

Description

technical field [0001] The invention belongs to the field of plant molecular genetic breeding research, and relates to a molecular marker linked with the ms5 gene of muskmelon male sterility and its application. Background technique [0002] Melon (C ucumis melo L.) has obvious heterosis compared with other crops. Over the years, researchers and breeders at home and abroad have cultivated a large number of excellent first-generation melon hybrid seeds, creating huge economic benefits. However, at present, hybrid seed production still continues measures such as manual removal of female male flowers, artificial pollination, and bagging. The process is complicated, the workload is heavy, and the cost is high. It is easy to cause damage to flower organs, thereby causing a decline in yield. McCreight and Elmstrom (1984) pointed out that F 1 The cost of artificial seed production is 12-30 times of the cost of natural pollination. Male sterility is an important and stable and ef...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6858C12Q1/6895C12Q2600/13C12Q2600/156C12Q2521/301C12Q2531/113C12Q2565/125
Inventor 盛云燕于高波纪鹏郭晓红魏金鹏李德泽史闯
Owner HEILONGJIANG BAYI AGRICULTURAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More