Pfu DNA polymerase and preparation method thereof
A technology of polymerase and DNA molecules, applied in the direction of recombinant DNA technology, botany equipment and methods, biochemical equipment and methods, etc., can solve the problems that affect the application and promotion of Pfu enzyme, slow extension speed, and low sensitivity of Pfu enzyme amplification , achieve the effects of shortening the amplification reaction time, high sensitivity, and strong anti-interference ability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
example 1
[0028] Example 1: Preparation of Fast Pfu DNA polymerase
[0029] (1) Obtaining of Fast Pfu DNA polymerase expression strain: the DNA sequence (SEQ ID NO: 1) of Fast Pfu DNA polymerase was synthesized from the whole gene, primers Pr-1 and Pr-2 were synthesized, and the synthesized gene was used as a template, Using the corresponding primers, the product Nde1 and Xho1 obtained by PCR were double digested and connected to the pET30a vector digested with the same enzyme, transformed into DH5a, sequenced to obtain the correct positive expression plasmid: pET30a-Fast Pfu; and then this The plasmid was transformed into BL21(DE3) to obtain an expression strain; the primer sequences are as follows:
[0030] Pr-1: ATGATTTTAGATGTGGAT;
[0031] Pr-2: TCGAGCTAGGATTTTTTAATGTT;
[0032] (2) Inoculate the strain obtained in step (1) into the LB medium at 37°C at a ratio of 1:100, culture with shaking at 250rmp until OD600=0.6, add inducer 1mM IPTG, in order to improve the expression of sol...
example 2
[0051] Example 2: Preparation of Fast Pfu DNA polymerase
[0052] The steps of the present embodiment are the same as Example 1, and the difference is that in step (2), the bacterial strain is inoculated into the LB medium at a ratio of 1:20; Tis-Hcl, pH 8.0, 500mM NaCl) were mixed at a ratio of 1:5, that is, 1g of bacteria was added to 5ml of bacteriostasis buffer; the obtained target product Fast Pfu DNA polymerase, such as figure 2 As shown, as shown in the figure: we can obtain the target protein that is consistent with the theoretical molecular weight.
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com