Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Pfu DNA polymerase and preparation method thereof

A technology of polymerase and DNA molecules, applied in the direction of recombinant DNA technology, botany equipment and methods, biochemical equipment and methods, etc., can solve the problems that affect the application and promotion of Pfu enzyme, slow extension speed, and low sensitivity of Pfu enzyme amplification , achieve the effects of shortening the amplification reaction time, high sensitivity, and strong anti-interference ability

Inactive Publication Date: 2016-10-12
NOVOPROTEIN SCI INC
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the sensitivity of Pfu enzyme amplification is not high, and the slow extension speed (1kb / min) has brought inconvenience to many users, which has affected the application and promotion of Pfu enzyme.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pfu DNA polymerase and preparation method thereof
  • Pfu DNA polymerase and preparation method thereof
  • Pfu DNA polymerase and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0028] Example 1: Preparation of Fast Pfu DNA polymerase

[0029] (1) Obtaining of Fast Pfu DNA polymerase expression strain: the DNA sequence (SEQ ID NO: 1) of Fast Pfu DNA polymerase was synthesized from the whole gene, primers Pr-1 and Pr-2 were synthesized, and the synthesized gene was used as a template, Using the corresponding primers, the product Nde1 and Xho1 obtained by PCR were double digested and connected to the pET30a vector digested with the same enzyme, transformed into DH5a, sequenced to obtain the correct positive expression plasmid: pET30a-Fast Pfu; and then this The plasmid was transformed into BL21(DE3) to obtain an expression strain; the primer sequences are as follows:

[0030] Pr-1: ATGATTTTAGATGTGGAT;

[0031] Pr-2: TCGAGCTAGGATTTTTTAATGTT;

[0032] (2) Inoculate the strain obtained in step (1) into the LB medium at 37°C at a ratio of 1:100, culture with shaking at 250rmp until OD600=0.6, add inducer 1mM IPTG, in order to improve the expression of sol...

example 2

[0051] Example 2: Preparation of Fast Pfu DNA polymerase

[0052] The steps of the present embodiment are the same as Example 1, and the difference is that in step (2), the bacterial strain is inoculated into the LB medium at a ratio of 1:20; Tis-Hcl, pH 8.0, 500mM NaCl) were mixed at a ratio of 1:5, that is, 1g of bacteria was added to 5ml of bacteriostasis buffer; the obtained target product Fast Pfu DNA polymerase, such as figure 2 As shown, as shown in the figure: we can obtain the target protein that is consistent with the theoretical molecular weight.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a Pfu DNA polymerase and a preparation method thereof. The preparation method comprises constructing a Fast Pfu DNA polymerase prokaryotic expression vector, constructing an expression strain, inoculating a medium with the strain, carrying out induced expression, collecting bacteria, breaking the bacteria and carrying out purification to obtain the Pfu DNA polymerase. The preparation method utilizes a molecular evolution technology to reconstruct a common Pfu enzyme, prepares the novel Fast Pfu polymerase, has the characteristics of fast rate, high sensitivity and high interference resistance and is a novel high-fidelity DNA polymerase.

Description

technical field [0001] The invention belongs to the field of molecular biology reagents, in particular to a method for preparing Fast Pfu DNA polymerase. Background technique [0002] Pfu DNA polymerase (Pfu DNA polymerase), also known as Pfu polymerase, or Pfu enzyme, is found in the thermophilic archaeal organism Pyrococcus, a class of enzymes that can perform DNA replication in vivo, the enzyme contains Two protein subunits (P45 and P50) are polymers with a molecular weight of about 90kDa. The enzyme has both 5'-3'polymerase activity and 3'-5'exonuclease activity. Misincorporated bases can thus be corrected with high fidelity during polymerization reactions. In vitro experiments, in polymerase chain reaction (polymerase chain reaction, PCR), DNA fragments can be amplified rapidly and with high fidelity by using Pfu polymerase. However, the amplification sensitivity of Pfu enzyme is not high, and the extension speed is slow (1 kb / min), which brings inconvenience to many ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/12C12N15/54C12N15/70
CPCC12N9/1252C12Y207/07007
Inventor 石加加陈飞刘宽张冰
Owner NOVOPROTEIN SCI INC
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More