Unlock instant, AI-driven research and patent intelligence for your innovation.

Sequences of primers for isothermal amplification detection of five root-knot nematodes based on microfluidic chip technology and their applications

A microfluidic chip and root-knot nematode technology, which is applied in the measurement/testing of microorganisms, recombinant DNA technology, biochemical equipment and methods, etc., to achieve the effects of large number of detection indicators, saving reaction reagents, and strong specificity

Active Publication Date: 2019-11-15
NINGBO UNIV
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, this technology has been successfully applied to the simultaneous detection of multiple respiratory pathogens, multiple aquaculture pathogens (bacteria and viruses), and multiple food-borne pathogens. identification

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Sequences of primers for isothermal amplification detection of five root-knot nematodes based on microfluidic chip technology and their applications
  • Sequences of primers for isothermal amplification detection of five root-knot nematodes based on microfluidic chip technology and their applications
  • Sequences of primers for isothermal amplification detection of five root-knot nematodes based on microfluidic chip technology and their applications

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0088] Establishment of a method for the detection of root-knot nematode by isothermal amplification microfluidic chip

[0089] 1. Primer design: according to the internal transcriptional spacer sequence (rDNA-ITS) of the ribosomal DNA of apple root-knot nematode, the internal transcriptional spacer sequence (rDNA-ITS) of the ribosomal DNA of root-knot nematode Three pairs of primer sequences were designed for the intergenic region sequence (IGS2) of the nematode, the SCAR sequence of the root-knot nematode javanica, and the RAPD sequence of the root-knot nematode incognita. Detection of root-knot nematode, root-knot nematode peanut, root-knot nematode java, and root-knot nematode incognita, among which,

[0090] The primer sequences used to detect apple root-knot nematode are:

[0091] Mma-F3: TGCTGCTGGATCATTACAC,

[0092] Mma-B3: TCCTGGGCTCATTAAGTCT,

[0093] Mma-FIP: CGACGTATCCTCCAATCTTGTCGCAATGAGCCTTGTTATTG,

[0094] Mma-BIP: CGACTCTCGTCGTGTAACGGGATGGCACAACTGCTCAG,

...

Embodiment 2

[0135] Specificity determination of root-knot nematode microfluidic chip isothermal amplification detection using primers of the present invention

[0136]Genomic DNA of each nematode was extracted by using the method for extracting genomic DNA from the nematode population in step 2 of Example 1 above. Using the designed primers, the genomic DNA (10 3 pg / µL) as a template, the microfluidic chip isothermal amplification reaction was carried out according to steps 3, 4 and 5 of the above-mentioned Example 1, and the specificity of the primers was verified, and distilled water was used as a negative control. The result is as Figure 3-Figure 7 As shown, the specific LAMP primers designed for the four species except M. arachidis can specifically amplify their respective target species. The judgment of peanut root-knot nematode can be completed by combining the primers of root-knot nematode java, root-knot nematode incognita, and the general primers of three species of peanut, J...

Embodiment 3

[0138] Sensitivity determination of root-knot nematode microfluidic chip isothermal amplification detection using primers of the present invention

[0139] Using the method for extracting genomic DNA from nematode populations in step 2 of Example 1 above, the genomic DNA of each nematode was extracted and serially diluted 10 times. Firstly, select primers of each species, use different concentrations of nematode genomic DNA as templates, carry out real-time fluorescent LAMP reaction in PCR tubes, and preliminarily determine the detection sensitivity of the respective primers; The 10-fold gDNA was used as a template, and the LAMP reaction on the chip was carried out according to steps 3, 4 and 5 of the above-mentioned Example 1 to determine its sensitivity. The result is as Figure 9-19 As shown, use the primers provided by the invention to carry out the LAMP reaction in the tube ( Figure 9 - 13) and microfluidic chip reactions ( Figure 14 - 19), the sensitivities obtained...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses isothermal amplification detection primer sequences for five meloidogyne spp. based on a micro-fluidic chip technology and an application of the primer sequences. The primer sequences are characterized in that the three pairs of the primer sequences are designed in accordance with rDNA-ITS of meloidogyne mali, rDNA-ITS of meloidogyne hapla, an IGS2 sequence of meloidogyne arenria, an SCAR sequence of meloidogyne javanica and an RAPD sequence of meloidogyne incognita, and an isothermal amplification micro-fluidic chip detection system is established, so as to complete detection on the meloidogyne mali, the meloidogyne hapla, the meloidogyne arenria, the meloidogyne javanica and the meloidogyne incognita, wherein the various primer sequences are shown as SEQ ID NO.1-30. The primer sequences have the advantages of being rich in the quantities of detected species and sample, simple and convenient to operate, and high in sensitivity and specificity.

Description

technical field [0001] The invention relates to the detection of root-knot nematodes, in particular to a primer sequence for isothermal amplification detection of five kinds of root-knot nematodes based on microfluidic chip technology and an application thereof. Background technique [0002] Root-knot nematode (Meloidogyne spp.) is one of the groups with the largest variety, the widest distribution and the most serious damage among plant pathogenic nematodes. At present, there are mainly 23 kinds of nematodes that have been identified and distributed in China, among which 4 kinds of nematodes, such as root-knot nematode southern, root-knot nematode northern, root-knot nematode javanica, and peanut root-knot nematode, are widely distributed; Nematodes are of considerable research value because of their biological characteristics such as being able to overcome the resistance of the Mi antigen gene and being unable to parasitize Pasteurella puncturee. Apple root-knot nematode ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6888C12Q1/6844C12N15/11
CPCC12Q1/6844C12Q1/6888C12Q2565/629C12Q2561/113C12Q2563/107
Inventor 陈炯周前进
Owner NINGBO UNIV