Sequences of primers for isothermal amplification detection of five root-knot nematodes based on microfluidic chip technology and their applications
A microfluidic chip and root-knot nematode technology, which is applied in the measurement/testing of microorganisms, recombinant DNA technology, biochemical equipment and methods, etc., to achieve the effects of large number of detection indicators, saving reaction reagents, and strong specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0088] Establishment of a method for the detection of root-knot nematode by isothermal amplification microfluidic chip
[0089] 1. Primer design: according to the internal transcriptional spacer sequence (rDNA-ITS) of the ribosomal DNA of apple root-knot nematode, the internal transcriptional spacer sequence (rDNA-ITS) of the ribosomal DNA of root-knot nematode Three pairs of primer sequences were designed for the intergenic region sequence (IGS2) of the nematode, the SCAR sequence of the root-knot nematode javanica, and the RAPD sequence of the root-knot nematode incognita. Detection of root-knot nematode, root-knot nematode peanut, root-knot nematode java, and root-knot nematode incognita, among which,
[0090] The primer sequences used to detect apple root-knot nematode are:
[0091] Mma-F3: TGCTGCTGGATCATTACAC,
[0092] Mma-B3: TCCTGGGCTCATTAAGTCT,
[0093] Mma-FIP: CGACGTATCCTCCAATCTTGTCGCAATGAGCCTTGTTATTG,
[0094] Mma-BIP: CGACTCTCGTCGTGTAACGGGATGGCACAACTGCTCAG,
...
Embodiment 2
[0135] Specificity determination of root-knot nematode microfluidic chip isothermal amplification detection using primers of the present invention
[0136]Genomic DNA of each nematode was extracted by using the method for extracting genomic DNA from the nematode population in step 2 of Example 1 above. Using the designed primers, the genomic DNA (10 3 pg / µL) as a template, the microfluidic chip isothermal amplification reaction was carried out according to steps 3, 4 and 5 of the above-mentioned Example 1, and the specificity of the primers was verified, and distilled water was used as a negative control. The result is as Figure 3-Figure 7 As shown, the specific LAMP primers designed for the four species except M. arachidis can specifically amplify their respective target species. The judgment of peanut root-knot nematode can be completed by combining the primers of root-knot nematode java, root-knot nematode incognita, and the general primers of three species of peanut, J...
Embodiment 3
[0138] Sensitivity determination of root-knot nematode microfluidic chip isothermal amplification detection using primers of the present invention
[0139] Using the method for extracting genomic DNA from nematode populations in step 2 of Example 1 above, the genomic DNA of each nematode was extracted and serially diluted 10 times. Firstly, select primers of each species, use different concentrations of nematode genomic DNA as templates, carry out real-time fluorescent LAMP reaction in PCR tubes, and preliminarily determine the detection sensitivity of the respective primers; The 10-fold gDNA was used as a template, and the LAMP reaction on the chip was carried out according to steps 3, 4 and 5 of the above-mentioned Example 1 to determine its sensitivity. The result is as Figure 9-19 As shown, use the primers provided by the invention to carry out the LAMP reaction in the tube ( Figure 9 - 13) and microfluidic chip reactions ( Figure 14 - 19), the sensitivities obtained...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


