Tumor vascular endothelial cell marker 8 mutant, fusion protein and application thereof
A technology of endothelial cells and fusion proteins, applied in the field of molecular biology, can solve the problem of no progress in TEM8 structural research
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Example 1 Expression of TEM8 mutant MT4
[0036] 1. Construction of the expression plasmid of mutant MT4
[0037] Using L56A-PHAT2 as a template, amino acids 152, 154-159 were mutated by inverse PCR technology, and the reaction system was 50 μL, as shown in Table 1.
[0038] Table 1. PCR reaction system (1)
[0039]
[0040] The reaction conditions are:
[0041]
[0042] The PCR product was subjected to template digestion, phosphorylation and ligation overnight; DH5α competent cells were transformed, coated with Amp-containing LB plates, and cultured until clones grew.
[0043] Primer sequence:
[0044] MT4-R: GCCATCGAGTTTTTCCATCAGTCAAAGCAATGATG
[0045] MT4-F: CTGGTGCCGAGCTATTCAGAGAGGGAGGCTAATAG
[0046] 2. Protein expression and purification
[0047] The sequenced and confirmed MT4-PHAT2 plasmid was transformed into BL21 Escherichia coli competent, and after the clones were grown, single clones were picked and cultured overnight, and then expanded to 1L an...
Embodiment 2
[0067] Example 2 Expression and analysis of HAS-MT4 fusion protein
[0068] 1. Construction of fusion protein of HSA and MT4
[0069] Fusion with HSA is a commonly used method to prolong the half-life of proteins. In order to construct HSA-MT4 fusion protein more conveniently, we modified the existing yeast expression plasmid pMEX9K-HSA-CMG2, and inserted two unique restriction enzyme sites NgoMIV and SpeI between linker and CMG2, Use one of the restriction enzyme sites and the existing NotI on the plasmid to connect MT4 into the expression vector, as shown in the schematic diagram. Image 6 shown.
[0070] The PCR process includes two steps: the first step is to add NgoMIV / SpeI and NotI restriction sites at both ends of MT4. The reaction system was 50 μL, see Table 2 for details.
[0071] Table 2. PCR reaction system (2)
[0072]
[0073] The reaction conditions are:
[0074]
[0075] The second step of PCR is to add NgoMIV / SpeI restriction sites after the HSA-CMG...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Affinity constant | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 
PatSnap Eureka turns technology decisions into work you can execute. Powered by our Innovation Knowledge Graph, it runs expert workflows across engineering, life sciences, materials and intellectual property. Get your review-ready output in minutes.
