Engineering bacteria for producing trans-4-hydroxy-L-proline and construction method and application thereof

A technology of proline and hydroxyl, applied in the field of producing trans-4-hydroxy-L-proline, can solve problems such as time-consuming, high cost and the like

Active Publication Date: 2016-11-09
INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
View PDF2 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The common disadvantage of the above methods is that it takes a long time, and L-proline is used as the substrate, which is expensive

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Engineering bacteria for producing trans-4-hydroxy-L-proline and construction method and application thereof
  • Engineering bacteria for producing trans-4-hydroxy-L-proline and construction method and application thereof
  • Engineering bacteria for producing trans-4-hydroxy-L-proline and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0144] Embodiment 1, the preparation of recombinant cell

[0145] 1. Construction of recombinant vector pHBA

[0146] Construction of recombinant vectors expressing L-proline-4-hydroxylase (P4H), glutamate-5-kinase (ProB) and glutamate-5-semialdehyde dehydrogenase (ProA), the amino acid sequence of P4H As shown in SEQ ID No.1 in the sequence listing, P4H is encoded by the P4H gene shown in SEQ ID No.2, the amino acid sequence of ProB is shown in SEQ ID No.3 in the sequence listing, and the amino acid sequence of ProA is as shown in the sequence listing Shown in SEQ ID No.5, ProB is encoded by the ProB gene shown in the 12th-1115th nucleotide of SEQ ID No.4, and ProA is shown in the 1127-2380th nucleotide of SEQ ID No.4 The ProA gene codes. The specific method is as follows:

[0147]Preparation of the vector called pYB1S: Use P15ASal I_F: GTCGACGTGCGTCAGCAGAATATGTG and StrSphI_R: ACCTACCAAGGCAACGCTAT as primers, and vector pACYCDuet-1 (Novagen Company) as a template to ampli...

Embodiment 2

[0168] Example 2, using the recombinant cells of Example 1 to prepare trans-4-hydroxyl-L-proline

[0169] Using the recombinant cells of Example 1 to prepare trans-4-hydroxyl-L-proline, the experiment was repeated three times, and the specific steps of each repeated experiment were as follows:

[0170] Pick a single colony of pHBA / BW from the plate and place it in LB medium, culture it at 37°C and 220rpm for 10 hours to obtain the pHBA / BW bacterial liquid; inoculate the pHBA / BW bacterial liquid in 5052 autoinduction culture according to the inoculation amount of 1%. culture medium at 30°C and 220rpm for 16h to obtain the pHBA / BW culture solution; centrifuge the pHBA / BW culture solution at 4°C and 4200rpm for 10min and discard the supernatant to obtain the pHBA / BW crude cell. The pHBA / BW crude cells were washed twice with an aqueous sodium chloride solution with a concentration of 0.85% by mass of sodium chloride, centrifuged at 4°C and 4200 rpm for 10 min each time, and the ce...

Embodiment 3

[0180] Example 3. Optimization of the Conditions for the Preparation of Trans-4-Hydroxy-L-Proline Using Recombinant Cells

[0181] 1. Effect of α-ketoglutarate (α-KG) on the yield of trans-4-hydroxy-L-proline

[0182] According to the method of using recombinant cells to prepare trans-4-hydroxyl-L-proline according to Example 2, pHBA / BW is replaced by pHBA / ΔputA, and the transformation solution is replaced by 0mMα-KG transformation solution (0mMα-KG The transformation solution is composed of ultrapure water and solute, and the solute and its concentration are 100mM Tris, 50mM sodium glutamate, 4mM FeSO 4 and 8mM vitamin C, adjust the pH to pH7.0 with hydrochloric acid), 5mMα-KG conversion solution (5mMα-KG conversion solution is composed of ultrapure water and solute, solute and its concentration are 5mMα-KG, 100mM Tris, 50mM glutamine Sodium Oxide, 4mM FeSO 4 and 8mM vitamin C, adjust the pH to pH7.0 with hydrochloric acid), 25mMα-KG conversion solution (25mMα-KG conversion...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses engineering bacteria for producing trans-4-hydroxy-L-proline and a construction method and an application thereof. The construction method of the engineering bacteria provided by the invention includes the steps of A1) and A2): A1) introducing a L-proline-4-hydroxylase gene, a glutamate-5-kinase gene and a glutamate-5-semialdehyde dehydrogenase gene into a receptor cell; and A2) knocking an alpha-ketoglutaricdehydrogenase gene, an isocitratlyase gene or a proline dehydrogenase gene of the receptor cell out, or replacing a pyruvic oxidase gene of the receptor cell with an acetylcoenzyme A synthetase gene; and carrying out a reaction of the recombinant cell and a substrate to obtain the trans-4-hydroxy-L-proline. Experiments prove that the production method of the trans-4-hydroxy-L-proline can be used for production of the trans-4-hydroxy-L-proline.

Description

technical field [0001] The invention relates to an engineering bacterium for producing trans-4-hydroxyl-L-proline and its construction method and application. Background technique [0002] Trans-4-hydroxy-L-proline (trans-4-Hydroxy-L-proline, Hyp) is an imino acid widely present in animal glue and bone collagen, and its molecular formula is shown in formula 1. [0003] [0004] Trans-4-Hydroxy-L-proline can be used in the cosmetic and pharmaceutical product industries as an enhancer of collagen synthesis. It is also used in the food industry as a supplementary nutrient for many tissues such as skin, bones and digestive tract. In addition, trans-4-hydroxy-L-proline has a chiral molecule and is a useful chiral element in the synthesis of drugs. Useful derivatives thereof include MK-1220, polyamine-4-L-hydroxyproline and N-acetyl-hydroxyproline (oxaceiro). MK-1220 is considered to be a highly active hepatitis C virus protease inhibitor; polyamine-4-L-hydroxyproline is use...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12P13/24C12N15/70C12N1/21C12R1/19
CPCC12N9/0008C12N9/0026C12N9/0071C12N9/1217C12N9/88C12N9/93C12P13/24C12Y102/01041C12Y102/03003C12Y102/04002C12Y105/99008C12Y114/11C12Y207/02011C12Y401/03
Inventor林白雪崔丽袁慎键陶勇
OwnerINST OF MICROBIOLOGY - CHINESE ACAD OF SCI