Method and application for screening ultralow fucose cell line

A fucose, host cell technology, applied in chemical instruments and methods, biochemical equipment and methods, medical preparations containing active ingredients, etc., can solve the problems of inability to stably produce antibodies and unsuitable for production of cell lines, etc.

Active Publication Date: 2016-11-30
XUANZHU BIOPHARMACEUTICAL CO LTD +1
View PDF7 Cites 46 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0015] Kanda et al. (Kanda, Yamane-Ohnuki et al., 2006) disclosed that Lecl3 cells can produce 50-70% fucosylated antibodies, however this known cell line cannot stably produce antibodies
Therefore the Lecl3 cell line is not suitable as a production cell line

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method and application for screening ultralow fucose cell line
  • Method and application for screening ultralow fucose cell line
  • Method and application for screening ultralow fucose cell line

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0076] Example 1: Design and vector construction of TALEN targeting FUT8 gene sequence

[0077] 1. The target information of Fut8 gene is as follows:

[0078] Fut8CDS: The yellow background marks the approximate position of TALEN cutting DNA and forming a frameshift mutation

[0079] ATGCGGGCATGGACTGGTTCCTGGCGTTGGATTATGCTCATTCTTTTTGCCTGGGGGACCTTATTGTTTTATATAGGTGGTCATTTGGTTCGAGATAATGACCACCCTGACCATTCTAGCAGAGAACTCTCCAAGATTCTTGCAAAGCTGGAGCGCTTAAAACAACAAAATGAAGACTTGAGGAGAATGGCTGAGTCTCTCCGAATACCAGAAGGCCCTATTGATCAGGGGACAGCTACAGGAAGAGTCCGTGTTTTAGAAGAACAGCTTGTTAAGGCCAAAGAACAGATTGAAAATTACAAGAAACAAGCTAGGAATGATCTGGGAAAGGATCATGAAATCTTAAGGAGGAGGATTGAAAATGGAGCTAAAGAGCTCTGGTTTTTTCTACAAAGTGAATTGAAGAAATTAAAGAAATTAGAAGGAAACGAACTCCAAAGACATGCAGATGAAATTCTTTTGGATTTAGGACATCATGAAAGGTCTATCATGACAGATCTATACTACCTCAGTCAAACAGATGGAGCAGGTGAGTGGCGGGAAAAAGAAGCCAAAGATCTGACAGAGCTGGTCCAGCGGAGAATAACATATCTGCAGAATCCCAAGGACTGCAGCAAAGCCAGAAAGCTGGTATGTAATATCAACAAAGGCTGTGGCTATGGATGTCAACTCCATCATGTGGTTTACTGCTTCATGATTGCTTATGG...

Embodiment 2

[0106] Example 2: Design and vector construction of CRISPR / CAS9 targeting FUT8 gene sequence

[0107] 1. Construction of Cas9 / gRNA, design and synthesis of targets:

[0108] Fut8 sequence information:

[0109]

[0110]

[0111]

[0112] Green background: Shearing the DNA, resulting in the approximate location of the frameshift mutation

[0113] Yellow background: Cas9 / gRNA cuts DNA, forming the approximate position of frameshift mutation

[0114]

[0115]

[0116] According to the analysis of the protein conservative region, about 180aa (located in exon 4) is the conserved region of the Fut8 super family, so exon 4 and exon 5 were selected as the DNA region for designing the gRNA target.

[0117] CHO Fut8 genome sequence: exon 4

[0118]

[0119]

[0120] Exon 5:

[0121]

[0122]

[0123] Design gRNA target for gene knockout: PAM sequence in gray background

[0124] gRNA target site position 1: CCAGCTCTGTCAGATCTT

[0125] Reverse complement:...

Embodiment 3

[0130] Example 3: Knockout of FUT8 gene in CHOK1 cells by TALEN method and sorting of monoclonal

[0131] 1. Cell culture and transfection

[0132] The following steps are applicable to mammalian cells cultured in 6-well plates. For other culture materials, please refer to the scale adjustment for transfection. All numbers and volumes are calculated by well. The ratio of DNA (ug) to Lipofectamin2000 (ul) used in most cell lines is 1:2 to 1:3, transfecting high-density cells can obtain high transfection efficiency, high expression level and low cytotoxicity. Optimal transfection is required (see DNA transfection optimization table).

[0133] 1. Suspension cells: Before preparing the transfection reagent, 2-4×10 per well 6 The cells were inoculated in 1.5 ml medium without antibiotics.

[0134] 2. Preparation of transfection reagent, the amount of cells per well is as follows:

[0135] A. Dilute plasmid DNA (2ug each of TALEN-2L and TALEN-2R plasmids) with 250ul CD OptiCHO l...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method and application for screening an ultralow fucose cell line. The invention provides a method for constructing fucose deficit type host cells capable of expressing an antibody and an IgG-FC fusion protein, a detection method for the fucose activity of the antibody and the IgG-Fc fusion protein, and concrete application of the cell lines. The method provided by the invention is realized by highly-efficient knockout of fucose-based transferase (FUT8) gene in an engineering cell producing the antibodies and the IgG-Fc fusion protein through a TALEN (and / or CRISPR) technology; and through lens culinaris lectin (LCA) pressurizing, gene sequencing and a flow cytometry screening process, the host cells with highly-efficiently knocked-out fucose is obtained. Meanwhile, fucose deficit CHOK1 host cell lines are constructed into stable engineering cell lines capable of expressing antibody proteins; and after the antibody proteins are obtained, glycoform analysis is performed; and results show that fucose knockout efficiency reaches to 99% or above.

Description

field of invention [0001] The present invention involves the use of existing TALEN and / or CRISPR / CAS9 technology to delete or mutate the FUT8 gene of CHO cells, thereby blocking the pathway for producing fucose, and using the antibody or IgG-Fc expressed by the cell line for fusion The protein fucose content was significantly reduced, and the ADCC activity function was significantly improved. technical background [0002] TALEN (Transcription Activator-Like Effector Nuclease) used in the present invention is an artificially modified restriction endonuclease obtained by fusing the DNA binding domain of TALE with the DNA cutting domain of restriction endonuclease (FokI). Since the repetitive amino acid sequence module in the DNA binding domain of TALE can specifically bind to a single base, the target DNA sequence can be arbitrarily selected for modification in theory, and it is a very effective genome modification tool enzyme. [0003] TALEN binds to the target site of the g...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K16/00C07K16/46C12N15/85C12N5/10A61K39/395
CPCA61K39/00C07K16/00C07K16/46C07K2317/732C12N9/1051C12N15/85C12N2800/107C12Y204/01068
Inventor朱晓东张海涛
OwnerXUANZHU BIOPHARMACEUTICAL CO LTD