Efficient mediated T1R3 gene overexpression lentiviral vector and lentivirus and construction methods thereof
A gene overexpression, lentiviral vector technology, applied in the field of molecular biology, can solve the problems of low success rate of cell lines and low transfection efficiency, and achieve the effect of promoting stable expression
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] Example 1: T1R3 gene overexpression lentiviral vector construction.
[0045] 1. Artificially synthesized T1R3 gene, the DNA sequence of which is shown in SEQ ID NO.1.
[0046] 2. Use PrimeSTAR high-fidelity enzymes, use the artificially synthesized T1R3 gene as a template, and perform PCR amplification with the primers shown in Table 1:
[0047] Table 1
[0048] Primer name
Primer sequence (5'-3')
SEQ ID NO.
T1R3-F
agattctagagctagcaccaccatggatgctgggccctgctg
2
T1R3-R
agatccttgcggccgctcactcatgtttcccctg
3
[0049] The PCR reaction system and conditions are shown in Table 2:
[0050] Table 2
[0051] Reagent
volume
template
1μL
Upstream primer (10μM)
1μL
Downstream primer (10μM)
1μL
Prime STAR Max (2x)
10 μL
wxya 2 o
7μL
total capacity
20 μL
[0052] The PCR program is shown in Table 3:
[0053] table 3
[0054]
[0055] 3. Agarose...
Embodiment 2
[0071] Example 2: Packaging of T1R3 lentivirus
[0072] 1. Replace the HEK293 cells with a confluence of more than 80% with antibiotic-free medium DMEM+10% (v / v) FBS, 37°C, 5% (v / v) CO 2 Incubator for 2 hours.
[0073] 2. Mix the packaging plasmid mixture (pLP / VSVG+pLP1+pLP2, 3 μg each) and 4 μg T1R3 gene overexpression lentiviral vector in 400 μL 0.9% (w / v) saline, and add 50 μL transfection reagent Fitran, room temperature After standing and incubating for 20 minutes, slowly and evenly drop it into the culture dish containing HEK293 cells in step 1, and shake it properly; record it as the start time of transfection.
[0074] 3. After 4-6 hours of transfection, prepare to change the medium. After discarding the old medium, absorb an appropriate amount of PBS to gently rinse the cells for 1-2 times, and replace with DMEM medium containing 2% (v / v) FBS.
[0075] 4. Collect the supernatant 72 hours after transfection, centrifuge the collected supernatant at 3000rpm at 4°C for ...
Embodiment 3
[0078] Example 3: Cell Transfection
[0079] 1. Cultivate HEK293 cells in a 6-well cell culture plate. After the cells are completely adherent and confluent to 40%-50%, the cells can be transfected; before transfection, replace the cells in each well with 500 μL of fresh DMEM for complete culture Base, and 1 μL of polybrene (polybrene) was added to each well, and placed in an incubator for 1 h.
[0080] 2. Add 5 μL of the T1R3 lentivirus solution obtained in Example 2 to the two wells of the above-mentioned 6-well cell culture plate, and add 10 μL of the empty lentivirus solution to the cells in one well (the empty lentivirus solution and the T1R3 lentivirus solution The only difference is that it does not contain the T1R3 gene, and the rest of the preparation methods are the same), and the other well is used as a blank cell control. 2 , 95% relative humidity incubator.
[0081] 3. After 6 hours of transfection, suck away the medium in the well, and wash it twice with PBS; r...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 